Check patentability & draft patents in minutes with Patsnap Eureka AI!

Vaccine composition for porcine circovirus and swine influenza and its preparation method and use

A technology of porcine circovirus and vaccine composition, applied in the fields of botanical equipment and methods, biochemical equipment and methods, applications, etc.

Active Publication Date: 2016-06-29
PU LIKE BIO ENG
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is currently no report of a vaccine combining the prevention and / or treatment of porcine circovirus disease with swine influenza

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vaccine composition for porcine circovirus and swine influenza and its preparation method and use
  • Vaccine composition for porcine circovirus and swine influenza and its preparation method and use
  • Vaccine composition for porcine circovirus and swine influenza and its preparation method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Example 1 Preparation, identification and purification of porcine circovirus and swine influenza virus H1N1 fusion antigen

[0070] 1.1 PCR amplification of PCV2Cap gene

[0071]Using the gene sequence of the PCV2-SH strain (accession number: HM038027) in GeneBank (see the sequence table SEQIDNo.1 for details) as a template, a pair of primers (702bp, 233AA) were designed with the software PrimerPremier5.0 for amplifying PCV2- Cap gene, its two ends add BamHI and PstI restriction site respectively, under (PH) promoter, primer sequence is as follows:

[0072] PCV2-Cap-BamHI: CGGGATCCATGACGTATCCAAGGAGGC

[0073] PCV2-Cap-PstI: AACTGCAGTTAAGGGTTAAGTGTGGGGGC

[0074] The parameters of the PCR reaction are: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 50 s, annealing at 54.3°C for 30 s, extension at 72°C for 45 s, and after 35 cycles, extension at 72°C for 5 min; The product was identified, and PCV2-Cap gene DNA was recovered and purified with DNA Fragment ...

Embodiment 2

[0094] Example 2 Preparation, identification and purification of porcine circovirus and swine influenza virus H3N2 fusion antigen

[0095] 2.1 Sequence selection and primer setting

[0096] Using the gene sequence in GeneBank (accession number: CY107035.1) (see the sequence table SEQIDNo.5 for details) as a template, use the software PrimerPremier5.0 to design a pair of primers (663bp, 221AA) for amplifying the H3N2-HA2 gene. SmaI and KpnI restriction sites were added to both ends, located under the P10 promoter, and the primer sequences are as follows:

[0097] H3N2-HA2-SmaI upstream:

[0098] CCCCCGGGGGCATATTCGGCGCAATCGCAGGT

[0099] Downstream of H3N2-HA2-KpnI:

[0100] GGGGTACCAATGCAAATGTTGCATCTAATGTTG

[0101] The parameters of the PCR reaction are: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 50 s, annealing at 53.8°C for 45 s, extension at 72°C for 40 s, and after 35 cycles, extension at 72°C for 5 min; The product was identified, DNA was recovered ...

Embodiment 3

[0105] The preparation of embodiment 3 porcine circovirus, swine influenza virus vaccine composition

[0106] The porcine circovirus and porcine influenza virus fusion antigens prepared in Example 1-2 were diluted with PBS solution of pH 7.4 respectively, and the fusion antigens and mineral oil adjuvant diluted respectively were prepared as shown in Table 1, with 500 Stir at a speed of -800r / min for 10-15min, add thimerosal solution with a volume ratio of 1% before stopping the stirring, so that the final concentration does not exceed 1 / 10,000, fully oscillate and mix well, which is the vaccine composition 1, the vaccine composition Object 2. Store it at 2-8°C after aliquoting.

[0107] Table 1 swine influenza virus, porcine circovirus vaccine composition ratio

[0108]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a vaccine composition for preventing and / or treating porcine circovirus diseases and swine influenza and its preparation method and use. The vaccine composition comprises i, a porcine circovirus subunit antigen or a nucleic acid which is used for coding the porcine circovirus subunit antigen and can be expressed in a pig, and ii, a swine influenza virus subunit antigen or a nucleic acid which is used for coding the swine influenza virus subunit antigen and can be expressed in a pig. The invention also relates to a nucleic acid molecule, a recombinant plasmid and a host cell for treating and / or preventing two types of pig diseases.

Description

technical field [0001] The invention relates to a vaccine composition and a preparation method thereof for simultaneous treatment and / or prevention of porcine circovirus disease and / or swine flu. The present invention also relates to nucleic acid molecules, recombinant plasmids and host cells for simultaneous treatment and / or prevention of two porcine diseases. The present invention further relates to the application of the vaccine composition in the preparation of medicaments. Background technique [0002] Porcine circovirus disease is mainly caused by porcine circovirus (Porcinecircovirus, PCV). The disease is not only manifested as porcine postweaning multisystemic wasting syndrome (Postweaning multisystemic wasting syndrome, PMWS), but also associated with porcine dermatitis and nephropathy syndrome (porcinedermatitisandnephropathyysyndrome, PDNS), porcine respiratory disease complex (PRDC), proliferative and necrotizing pneumonia (PNP), congenital tremor (CT-All) and o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/295A61K39/12A61K39/145C12N15/34C12N15/44C12N15/70C12N15/866C12N1/21C12N5/10A61P31/20A61P31/16
Inventor 张许科孙进忠杨青原田克恭
Owner PU LIKE BIO ENG
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More