HPV16E7 monoclonal antibody and preparation method and application thereof

A HPV16E7, monoclonal antibody technology, applied in the direction of antibodies, chemical instruments and methods, anti-tumor drugs, etc., can solve the problems of high false-positive rate of monitoring results and difficult implementation in small hospitals, and achieve high application value.

Active Publication Date: 2016-07-27
SHANGHAI PUTUO DISTRICT CENT HOSPITAL
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The clinical diagnosis related to HPV16 infection mainly relies on PCR-based molecular biology methods. This method has the disadvantages of high requirements for equipment, personnel and space conditions, and high false positive rate of monitoring results. It is difficult to implement in small hospitals.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HPV16E7 monoclonal antibody and preparation method and application thereof
  • HPV16E7 monoclonal antibody and preparation method and application thereof
  • HPV16E7 monoclonal antibody and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0035] The present invention provides a preparation method of HPV16E7 monoclonal antibody, comprising the following steps,

[0036] Step 1, HPV16E7 gene amplification

[0037] Using HPV16 positive secretion as a template for PCR amplification, the upstream primer sequence is shown in SEQNO.1, and the downstream primer sequence is shown in SEQNO.2;

[0038] Step 2, obtaining HPV16E7 recombinant protein

[0039] Using the PCR product obtained in recovery step 1 to carry out HPV16E7 expression vector construction and induced expression, and carry out the purification of HPV16E7 recombinant protein;

[0040] Step three, immunization

[0041] The antigen used is the purified HPV16E7 recombinant protein obtained in step 2;

[0042] Step 4, cell fusion to obtain hybridoma cells;

[0043] Step 5, screening positive clones of the hybridoma cells obtained in step 4 to obtain specific HPV16E7 monoclonal antibody hybridoma cells;

[0044] Step six, using the specific HPV16E7 monoclonal...

Embodiment 1

[0046] The preparation of embodiment one HPV16E7 antigen

[0047] First, design and synthesize HPV16E7 primers, and design a pair of specific primers based on the HPV16E7 gene sequence released by NCBI. Upstream primer (SEQNO.1): 5'-CGC GGATCC ATGCATGGAGATACACCTACATTG' (the underlined part is the BamHI restriction site); downstream primer (SEQNO.2): 5'-CCG CTCGAG CTATTATGGTTTCTGAGAACAGATG-3' (the underlined part is the XhoI restriction site).

[0048] Then, the HPV16E7 gene was amplified, and the HPV16 positive secretion was used as a template for PCR amplification. The reaction system is as follows: 10×PCR buffer 2μl, MgCL 2 (25mmol / L) 1.5ul, dNTP0.4μl, upstream and downstream primers 0.5μl, template DNA 1μl, Taq enzyme 0.2μl, deionized water 13.9μl; reaction conditions: 94°C for 5min, 94°C, 45s→56°C, 45s→72°C, 45s, 30 cycles, 72°C extension for 7min, the results are attached figure 1 As shown (Note: M: marker; 1: negative specimen; 2: HPV16 positive specimen).

[004...

Embodiment 2

[0051] The preparation of embodiment secondary anti-HPV16E7 monoclonal antibody

[0052] 1) Immunization of mice Eight-week-old Balb / C mice were immunized with the purified HPV16E7 antigen in Example 1. The way of immunization is multi-point subcutaneous injection, the immunization dose is 0.05 mg / monkey, and the immunization interval is 2 weeks. Complete Freund's complete adjuvant was added for the first immunization, followed by three times of immunization with Freund's incomplete adjuvant, and finally the antigen solution was used as a shock immunization.

[0053] 2) Cell fusion and hybridoma cell selection After 3 days of shock immunization, mouse splenocytes were taken to fuse with SP2 / 0 cells, and HAT was used to select culture at 37°C, 5% CO 2 cultured in an incubator. After 10 days, use HPV16E7 as the antigen-coated ELISA plate (10ng / well), detect the culture supernatant and screen the positive clones by indirect ELISA, and continue to limit the dilution of the scree...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an HPV16E7 monoclonal antibody and a preparation method and application thereof.A correct sequence of an HPV16E7 gene is obtained from a clinical specimen through cloning, the gene effectively expresses HPV16E7 fusion protein in the form of soluble protein in BL21(DE3) escherichia coli under the induction of IPTG after being correctly inserted in a pET28a(+) prokaryotic expression plasmid, the HPV16E7 monoclonal antibody is successfully prepared through a protein immunized BALB / C mouse, the antibody can recognize a prokaryotic and eukaryotic expression HPV16E7 antigen, quite high application value is achieved for detection of the HPV16E7 antigen, and a basis is provided for research of protein and related diseases and establishment of a detection method of the HPV16 antigen.

Description

technical field [0001] The invention relates to the field of monoclonal antibody preparation, in particular to a HPV16E7 monoclonal antibody and its preparation method and application. Background technique [0002] Human papillomavirus (humanpapillomavirus, HPV) belongs to the papilloma vacuolar virus of Papovaviridae, which is a spherical DNA virus that can cause squamous epithelial proliferation of human skin and mucous membranes. It is currently a confirmed carcinogenic virus. The HPV infection rate in women's cervical cancer tissues in my country is more than 95%, among which HPV16 is the most pathogenic type among papillomaviruses and the most closely related to the pathogenesis of cervical cancer. According to statistics from the International Cancer Research Center (IARC), HPV16 infection accounts for 51.0% of cervical cancer specimens. The clinical diagnosis related to HPV16 infection mainly relies on PCR-based molecular biology methods. This method has the disadvan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/08A61K39/395A61P35/00G01N33/577G01N33/569
CPCC07K16/084C07K2317/565
Inventor康向东吴蓉孔倩倩相芬芬詹月萍许建蒋洁敏乐红红郝文斌
OwnerSHANGHAI PUTUO DISTRICT CENT HOSPITAL