Unlock instant, AI-driven research and patent intelligence for your innovation.

Oligonucleotide probe

An oligonucleotide probe and probe technology, applied in the field of oligonucleotide probes, can solve problems such as high application threshold, high cost, and difficulty in wide-scale promotion, and achieve stable probes, simple preparation, and wide application range wide effect

Active Publication Date: 2016-07-27
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF3 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although these technologies have higher safety and stability, they still need to be marked by chemical means, which is costly, has a high application threshold, and is difficult to promote on a large scale

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligonucleotide probe
  • Oligonucleotide probe
  • Oligonucleotide probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1, with reference to attached figure 1 , design PCR primers and probes for a synthetic target nucleic acid molecule.

[0045] Synthetic target sequence T1:

[0046] 5'- TTAGTTAAT CGGCGGGTTTTCGACGGGAAT -3'

[0047] Front primer (T1-F):

[0048] 5'-P-AAATACGAACCAAAACGCTCCCC-3'

[0049] Rear primer (T1-R):

[0050] 5'-TTATATGTCGGTTACGTGCGTTTATAT-3'

[0051] Probe (P1):

[0052] 5'-P- ATTCCCGTCGAAAACCCGCCG AAA AAA-3'

[0053] The front primer (T1-F) corresponds to the part in bold in the template (T1), the back primer (T1-R) corresponds to the italic part of T1, and the structure of the probe (P1) consists of a sequence complementary to the template sequence (underlined) , with figure 1 -a), stem sequence (marked in black box, appended figure 1 -b1, b2), ring sequence (the part between the two black boxes, attached figure 1 -c) consists of three parts, wherein the italic bold part is the G-quadruplex sequence introduced by the probe, which...

Embodiment 2

[0054] Embodiment 2, single-stranded target nucleic acid detection example

[0055] The probe designed in Example 1 was used to detect the single-stranded target nucleic acid T1.

[0056] Refer to attached figure 2 The principle of single-stranded DNA detection shown is to add 2.5ul 10×Taqbuffer, 0.3uMT1, 1μMP1, 108mM NaCl solution to the 25ul color reaction system in sequence, then add 1ul Lambda enzyme, digest at 37°C for 30min, and finally add 1uM Hemin, 2mMABTS, 1mM H 2 o 2 . A negative control is: system without T1. Observe the color change with the naked eye or measure the absorbance at a wavelength of 414nm with a microplate reader. The color results are attached Figure 4 As shown, when T1 is not included in the system, no color signal visible to the naked eye is produced, and when T1 exists in the system, it can be observed that the reaction solution is obviously green. attached Figure 5 For the measurement result of chromogenic absorption value, when the con...

Embodiment 3

[0057] Embodiment 3, double-stranded target nucleic acid detection example

[0058] Use T1 as a template to perform PCR to form a double-stranded nucleic acid, and use the primers and probes designed in Example 1 to detect the PCR double-stranded nucleic acid product.

[0059] Refer to attached image 3 The principle of double-stranded DNA detection shown above is to firstly take a small amount of T1 for ordinary PCR to obtain a large amount of double-stranded products containing 5'-phosphorylated T1 complementary strands, and then add probes and Lambda enzymes to the PCR system to digest and release G- Quadruplex reporter molecules, and finally display the results by color reaction.

[0060] (1) PCR reaction system and reaction conditions

[0061]

[0062] The PCR conditions were: 94°C pre-denaturation for 2 minutes; 94°C denaturation for 30s, 60°C renaturation for 45s, 72°C extension for 45s, 12 cycles.

[0063] A negative control is: system without T1.

[0064] (2) A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of nucleic acid probes and provides an oligonucleotide probe. The probe sequentially comprises a sequence complementary with a target sequence, a G-quadruplex closing sequence and a G-quadruplex sequence from the 5' terminal to the 3' terminal, wherein the G-quadruplex closing sequence is complementary with part of G-quadruplex sequence to form a stable hairpin structure, and the G-quadruplex sequence is closed in the probe. During target molecule detection, the probe firstly recognizes the target sequence and forms a double-stranded structure, then, the hairpin structure is opened under the digestion action of Lambda exonuclease, the G-quadruplex sequence is released, the procedures are repeated, finally, a trace amount of target molecule information is converted into a large quantity of G-quadruplex sequences, and the G-quadruplex sequences are converted into readable light signals, electric signals and the like. The probe has the advantages of good stability, low cost, easiness in preparation, high throughput and high sensitivity and specificity, can directly detect single-stranded nucleic acid and can also indirectly detect double-stranded nucleic acid and other molecules capable of inducing generation of single-stranded nucleic acid.

Description

technical field [0001] The invention relates to nucleic acid probe technology, in particular to an oligonucleotide probe capable of detecting target molecules. Background technique [0002] Oligonucleotide is a kind of short-chain nucleic acid with only dozens of bases. Because of its inherent nucleic acid complementary hybridization characteristics and simple and operable structural characteristics, it is often used as a nucleic acid after being labeled with a certain chemical group. Probes, which convert nucleic acid signals into optically or electrically readable signals, are powerful tools for nucleic acid detection and analysis. Such probes are oligonucleotide probes. The probe labeling method used earlier is mainly radioactive isotope labeling, but it is easy to cause radioactive contamination, and there are problems such as short half-life of the isotope, instability, high cost, inconvenient operation, and difficulty in commercialization. Therefore, in recent years, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/68
CPCC12Q1/682C12Q2525/301C12Q2521/319C12Q2525/185
Inventor 唐卓李美
Owner CHENGDU INST OF BIOLOGY CHINESE ACAD OF S