Application of human IARS2 gene and related medicines thereof
A gene and drug technology, applied in the field of human IARS2 gene and its related drugs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0079] Example 1 Preparation of RNAi lentivirus for human IARS2 gene
[0080] 1. Screening for effective siRNA targets against the human IARS2 gene
[0081] Retrieve IARS2 (NM_018060) gene information from Genbank; design effective siRNA targets for IARS2 gene. Table 1 lists one of the effective siRNA target sequences for the IARS2 gene.
[0082] Table 1 is targeted at the siRNA target sequence of human IARS2 gene
[0083] SEQ ID NO
TargetSeq
1
GTACTTGCAGTCATCCATTAA
[0084] 2. Preparation of lentiviral vector
[0085] Aiming at the siRNA target (taking SEQIDNO: 1 as an example) synthetic double-stranded DNA Oligo sequence (table 2) containing AgeI and EcoRI restriction endonuclease at both ends; Acting on the pGCSIL-GFP vector ( Provided by Shanghai Jikai Gene Chemical Technology Co., Ltd., figure 1 ), to linearize it, and identify the digested fragments by agarose gel electrophoresis.
[0086] Table 2 Double-stranded DNA Oligo with sticky...
Embodiment 2
[0105] Example 2 Real-time fluorescent quantitative RT-PCR method to detect the silencing efficiency of IARS2 gene
[0106] The glioma U251 cells in the logarithmic growth phase were trypsinized to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, U251:5) value, an appropriate amount of the virus prepared in Example 1 was added, the culture medium was replaced after 24 hours of cultivation, and the cells were collected after the infection time reached 5 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV instruction manual of Promega Company, RNA was reverse-transcribed to obtain cDNA (see Table 7 for the reverse transcription reaction system, react at 42° C. for 1 h, and then bathe in a water bath at 70° C. for 10 min to inactivate reverse transcriptase).
[0...
Embodiment 3
[0113] Example 3 Detection of proliferation ability of tumor cells infected with IARS2-siRNA lentivirus
[0114] The glioma U251 cells in the logarithmic growth phase were trypsinized to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, U251:5), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells in the experimental group were collected in the logarithmic growth phase. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 2000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the plate was detected and read once a day with a Cellomics i...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 