Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of human IARS2 gene and related medicines thereof

A gene and drug technology, applied in the field of human IARS2 gene and its related drugs

Active Publication Date: 2016-07-27
SHANGHAI JI KAI GENE TECH CO LTD
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, the experimental reports on the IARS2 gene in tumor-related fields are still blank, especially in the field of human glioma research.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of human IARS2 gene and related medicines thereof
  • Application of human IARS2 gene and related medicines thereof
  • Application of human IARS2 gene and related medicines thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Example 1 Preparation of RNAi lentivirus for human IARS2 gene

[0080] 1. Screening for effective siRNA targets against the human IARS2 gene

[0081] Retrieve IARS2 (NM_018060) gene information from Genbank; design effective siRNA targets for IARS2 gene. Table 1 lists one of the effective siRNA target sequences for the IARS2 gene.

[0082] Table 1 is targeted at the siRNA target sequence of human IARS2 gene

[0083] SEQ ID NO

TargetSeq

1

GTACTTGCAGTCATCCATTAA

[0084] 2. Preparation of lentiviral vector

[0085] Aiming at the siRNA target (taking SEQIDNO: 1 as an example) synthetic double-stranded DNA Oligo sequence (table 2) containing AgeI and EcoRI restriction endonuclease at both ends; Acting on the pGCSIL-GFP vector ( Provided by Shanghai Jikai Gene Chemical Technology Co., Ltd., figure 1 ), to linearize it, and identify the digested fragments by agarose gel electrophoresis.

[0086] Table 2 Double-stranded DNA Oligo with sticky...

Embodiment 2

[0105] Example 2 Real-time fluorescent quantitative RT-PCR method to detect the silencing efficiency of IARS2 gene

[0106] The glioma U251 cells in the logarithmic growth phase were trypsinized to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, U251:5) value, an appropriate amount of the virus prepared in Example 1 was added, the culture medium was replaced after 24 hours of cultivation, and the cells were collected after the infection time reached 5 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV instruction manual of Promega Company, RNA was reverse-transcribed to obtain cDNA (see Table 7 for the reverse transcription reaction system, react at 42° C. for 1 h, and then bathe in a water bath at 70° C. for 10 min to inactivate reverse transcriptase).

[0...

Embodiment 3

[0113] Example 3 Detection of proliferation ability of tumor cells infected with IARS2-siRNA lentivirus

[0114] The glioma U251 cells in the logarithmic growth phase were trypsinized to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, U251:5), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells in the experimental group were collected in the logarithmic growth phase. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 2000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the plate was detected and read once a day with a Cellomics i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a human IARS2 gene and related medicines thereof. The invention discloses the application of the human IARS2 gene to tumor therapy, tumor diagnosis and medicine preparation. The invention also further constructs human IARS2 gene siRNA (small interfering ribonucleic acid), a human IARS2 gene interfering nucleic acid construct and a human IARS2 gene interfering lentivirus and discloses applications of human IARS2 gene siRNA, the human IARS2 gene interfering nucleic acid construct and the human IARS2 gene interfering lentivirus. The siRNA provided by the invention or the nucleic acid construct and lentivirus containing the sequence of siRNA can specifically inhibit expression of the human IARS2 gene, in particular, the lentivirus can efficiently infect target cells and efficiently inhibit expression of the IARS2 genes in the target cells and then inhibit growth of tumor cells and promote tumor cell apoptosis and has great significance in tumor therapy.

Description

technical field [0001] The present invention relates to the field of biotechnology, and more specifically relates to the use of human IARS2 gene and related medicines. Background technique [0002] RNA interference (RNAi) is short double-stranded RNA (dsRNA) composed of nucleotides for post-transcriptional gene silencing. It can efficiently and specifically block the expression of a specific gene in the body, leading to its degradation, thereby causing the silencing of a specific gene in the organism, and causing the cells to show the absence of a certain gene phenotype. It is a commonly used research gene emerging in recent years. Functional, laboratory techniques for finding cures for disease. Studies have shown that double-stranded RNA with a length of 21-23nt can specifically cause RNAi at the transcriptional and post-transcriptional levels (TuschlT, ZamorePD, SharpPA, BartelDP. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21to23nucleotide int...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/113C12N15/867A61K31/713A61P35/00
Inventor 谭畅杨岳微高博谢胜华金杨晟曹跃琼
Owner SHANGHAI JI KAI GENE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com