Application of paddy rice temperature sensitive male sterility gene TMS10 and fertility restoration method

A male sterility gene, TMS10 technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problem of high human and financial resources for reproduction and preservation

Active Publication Date: 2016-08-03
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Three-line seed production has indeed provided a large number of excellent varieties, but in practice, the reproduction and preservation of each line requires a lot of manpower and financial resources
However, the number of genes controlling photothermosensitive male sterility that has been reported so far is still very small, so the discovery and research of new photothermosensitive sterile materials provides more clues and the possibility of increasing production for breeding work

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of paddy rice temperature sensitive male sterility gene TMS10 and fertility restoration method
  • Application of paddy rice temperature sensitive male sterility gene TMS10 and fertility restoration method
  • Application of paddy rice temperature sensitive male sterility gene TMS10 and fertility restoration method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1, the method for the creation of rice male sterile lines

[0042] 1.1 Create tms10 rice male sterile lines by genetic engineering or other means

[0043] The sequence of the coding region of the TMS10 gene in this example is shown in SEQ ID NO.2. The japonica rice variety tms10 mutant material in this example is obtained from the conventional japonica rice variety Wuyujing No. 7 (also known as 9522) through sequence variation of the TMS10 gene, and the tms10 mutant in the indica rice material Huanghuazhan variety is obtained from the japonica rice variety Thermosensitive Sterility The mutant was obtained through repeated backcrossing with indica rice Huanghuazhan.

[0044] 1.2 Cloning of rice fertility control protein gene

[0045] Utilize the population of rice gene location cloning (map-based cloning or position cloning) composed of the fertility control protein gene TMS10 and its mutant gene tms10 constructed by the inventor, which is clear to those s...

Embodiment 2

[0066] Embodiment 2 tms10 Mutant Physicity Transformation Conditions and Its Application in Rice Seed Production

[0067] 2.1 Conditions for sex conversion of tms10 mutant

[0068] Through years of experiments, the phenotype of tms10 differentiated when the rice was treated from the panicle differentiation period to the anther meiosis period during the rice growth period. Observations showed that the wild type could form normal pollen grains and set seeds normally under the conditions of 12h-14.5h light and 22-28°C. The tms10 mutant was completely recovered from the fertility under the condition of 12h-14.5h under the light at a low temperature of 22°C ( figure 1 D, 1J), able to firm normally. The tms10 mutant can form a small amount of mature pollen grains under the light of 12h-14.5h and the temperature between 23-26℃, and a small amount of fruiting. With the increase of temperature, the pollen iodine staining rate and seed setting rate both decrease. The tms10 mutant d...

Embodiment 3

[0073] Embodiment 3 restores the method for tms10 mutant male sterility trait

[0074] Transferring the genomic nucleotide sequence encoding the TMS10 gene into the mutant tms10 plant can restore the mutant to the wild-type phenotype.

[0075] Primers used from rice Nipponbare BAC clone (OSJNba18M09):

[0076] POS9-1F5'AAGTCGACGACATTAAGTTTGGGCCGAGATATG3'(SalI) (SEQ ID NO.5)

[0077] POS9-1R5'AAACACGTGGGACTAGTTGTATTTTCCCAGACACAATTCC'3 (PmacI) (SEQ ID NO.6)

[0078] POS9-2F5'GGCTTCACTGCAGCATTAATGTTATG'3 (PstI) (SEQ ID NO.7)

[0079] POS9-2R5'TTGTTTGTCAACAAATGGAAGATG'3 (SpeI) (SEQ ID NO.8)

[0080] POS9-3F5'TTCTGCTAACACTAGTTCATCTTCCATTTGTTGACAAA'3 (SpeI) (SEQ ID NO.9)

[0081] POS9-3R5'ACCTGTAATTCACACGTGTAAAACTAAAGTACTAACACA'3 (SpeI) (SEQ ID NO.10)

[0082] The 9236bp (SEQ ID NO.11) genome sequence fragment of the TMS10 gene was inserted into the pCAMBIA1301 vector step by step.

[0083] The fragment was divided into three fragments and inserted through three restriction ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of a paddy rice temperature sensitive male sterility gene TMS10 and a fertility restoration method. The amino acid sequence of TMS10 is represented by SEQ ID No.1. A conventional method is adopted to knock, change or inhibit TMS10 gene to reduce the expression level of TMS10 gene in common paddy rice species so as to obtain paddy rice male sterility line. The prepared paddy rice sterility line does not have abnormal phenotype during the vegetative growth phase; anther development is abnormal during the reproductive stage; the expressions of the phenotype are the same in the mutants of non-glutinous rice and japonica rice; the paddy rice is sterile at an average temperature of 28 DEG C, and paddy rice is fertile at an average temperature of 22 DEG C. The temperature sensitive characteristic, which is utilized during the process of two line hybrid seed production, is widely used in agricultural production.

Description

technical field [0001] The invention belongs to the technical field of rice breeding, and in particular relates to the application of a rice temperature-sensitive male sterility gene TMS10 and a method for restoring fertility. Background technique [0002] Rice is one of the world's major food crops, feeding the world's rice-based population. Therefore, improving rice yield and quality has become a national economy and people's livelihood issue. Since the first green revolution, along with the application of dwarf varieties, three-line hybrid seed production and two-line hybrid seed production have successively become important factors for increasing production. At present, the methods of hybrid rice breeding commonly used in production include three-line hybrid rice and two-line hybrid rice. The three lines include sterile line, maintainer line and restorer line. Three-line seed production has indeed provided a large number of excellent varieties, but in practice, the re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82A01H5/00C07K14/415C12N15/29A01H1/02
CPCA01H1/02C07K14/415C12N15/8205C12N15/8231
Inventor张大兵梁婉琪余君萍袁政陈明姣罗治靖
OwnerSHANGHAI JIAO TONG UNIV