IHF protein-based gene mutation method
A gene and protein technology, applied in the field of gene mutation based on IHF protein, can solve the problems of high requirements for transportation and storage methods, complicated preparation process, and low temperature resistance, and achieve the effect of reducing unnecessary interference
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] The preparation of embodiment 1 IHF protein
[0034] 1) IHF (NC_000913.3) is derived from Escherichia coli and is a member of the DNA binding protein DNABII family. It is a heat-resistant small molecular protein similar to histone that can bind to double-stranded DNA. IHF is composed of α subunit (himA code, 11.35kD) and β subunit (hip code, 10.65kD).
[0035] The IHFα or IHFβ subunit gene fragments derived from Escherichia coli were recombined and inserted into the PET-22b expression vector, and the recombinant vector was cloned after transformation, and the recombinant vector was further verified by colony PCR, restriction enzyme digestion and sequencing. The vector is named PET22-IHFα or pET22-IHFβ;
[0036] 2) Transform the constructed recombinant vector pET22-IHFα or pET22-IHFβ into protein expression engineering bacteria BL21 competent cells, screen positive clones on the ampicillin plate, pick positive clones and inoculate them into LB liquid medium with ampicil...
Embodiment 2
[0047] Example 2 Primer Design
[0048] 1) We use a gene sequence of Escherichia coli genome and send it to GenScript for gene fragment synthesis. The sequence of the gene fragment is shown in SEQ ID NO.1:
[0049] ATGAATAAATCTCCAATTGATCGACAAGATTGCTGCAGGGGCTGATATCTCTAAAGCTGCGGCTGGCCGTGCGTTAGAT CTATTATTGC TCCGTAACTGAATCTCTGAAAGAAGGGGATGATGTAGCACTGGTAGGTTTTGGTACTTTTGCCGTTAAAGAGCGTGCTGCCCGTACTGGCCGCAACCCGCAGACCGGTAAAGAGATCACCATCGCTGCTGCTAAAGTACCGAGCTTCCGTGCAGGTAAAGCACTGAAAGACGCGGTAAACTAA;
[0050] Mutation site: 79th G-C, 90th T-A, we will mutate the 79th and 90th positions of the original sequence. And the gene is divided into two DNA fragments with overlapping regions, the overlapping regions include mutation sites; the length of the DNA fragments in the overlapping regions is 15-25bp;
[0051] 2) Primer design: software used: GenSearch designs a pair of gene full-length amplification primers and at least a pair of mutation introduction primers, the present invention desig...
Embodiment 3
[0056] Embodiment 3 segmental PCR
[0057] 1) Segmented PCR amplifies the target gene, and introduces mutations in the overlapping region. The two tubes of PCR are shown in Table 2, and the system in each tube is 50 μl:
[0058] The first tube: add various reagents as shown in Table 2
[0059] Table 2 The first stage PCR reaction system
[0060] Reagent
Usage amount (μl)
Final concentration
2×Phusion Master Mix
25
1×
Primer 1
0.5
25pmol
Primer 2
0.5
25pmol
protogene fragment
1
Sterile distilled water
23
total capacity
50
[0061] The second tube: the addition of each reagent is shown in Table 3:
[0062] Table 3 The second stage PCR reaction system
[0063] Reagent
Usage amount (μl)
Final concentration
2×Phusion Master Mix
25
1×
Primer 3
0.5
25pmol
Primer 4
0.5
25pmol
protogene fragment
1 ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com