Unlock instant, AI-driven research and patent intelligence for your innovation.

CrRNA that specifically recognizes gs gene and its application

A gene-specific technology, applied in the field of crRNA that specifically recognizes GS gene, can solve problems such as low efficiency and complex knockout process, and achieve the effects of high transfection efficiency, reduced clone number, and improved efficiency.

Active Publication Date: 2019-04-16
苏州晟济药业有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This patent can only knock out the sixth exon of the GS gene, which is inefficient and complicated.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CrRNA that specifically recognizes gs gene and its application
  • CrRNA that specifically recognizes gs gene and its application
  • CrRNA that specifically recognizes gs gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1: Construction of CRISPR-Cas9 expression system for GS gene

[0065] The GS gene of Chinese hamster ovary cells contains 7 exons, among which exons 2~7 encode the expression of GS protein ( figure 1 ), which plays a vital role in normal function. The crRNA sequences were designed for the 2-7 exons of GS gene. Using these crRNA sequences and Cas9 protein can make the expressed GS protein lose its function. The partial sequence of exon2~7 of GS is as follows (exons are marked with an underscore "_____"):

[0066] SEQ ID NO.17:

[0067] TGCCTCTTACGCAATTCCTGCAGGGGACCCCCTTCAGAGTAGATGTTAATGAAATGACTTTTGTCTCTCCAGAGCACCTTCCACC ATGGCCACCTCAGCAAGTTCCCACTTGAACAAAAACATCAAGCAAATGTACTTGTGCCTGC CCCAGGGTGAGAAAGTCCAAGCCATGTATATCTGGGTTGATGGTACTGGAGAAGGACTGCGCTGCAAAACCCGCACC CTGGACTGTGAGCCCAAGTGTGTAGAAG GTGAGCATGGGCAGGAGCAGGACATGTGCCTGGAAGTGGGCAAGCAGCCTGAGATTTGACCTTCCTTCTGTTTTGTTTGCAAAGTCTTTCAAAAGCAGGTCTCTTCAGGCCTCAGTCAGTCACCCGTAAGCTGCCGAGTAGTCTGGAGG

[0068] SEQ ID NO.18:

[0069] AC...

Embodiment 2

[0081] Example 2: Knockout and verification of GS gene on CHO-K1 cells

[0082] The designed crRNA and Cas9 protein expression vectors were transfected into CHO-K1 cells acclimated with CD medium, and a total of 16 transfections or combinations of A to P were designed.

[0083] CHO-K1 cells were purchased from ATCC, and DMEM / F12 basic medium was used for cell culture, supplemented with 5% fetal bovine serum. The expanded CHO-K1 cells were cultured in suspension using CD CHO medium, and glutamine and HT additives were added.

[0084] After the cells are adapted to suspension culture, the crRNA and Cas9 protein expression vectors are transfected into the cells. Puromycin was added to the cell culture medium after 48 hours of transfection. After 4 days of culture, the surviving cells were selected for subclonal culture. After the subclonal cells grow, the cells are transferred to L-Gln and L-Gln-free medium for culture. The clones that cannot grow in the medium without L-Gln but can ...

Embodiment 3

[0090] Example 3: Experiment of expressing antibodies in GS gene-deficient cells

[0091] The selected GS KO1 and GS KO2 cells were subjected to antibody expression transfection experiments, and wild-type CHO-K1 cells were used as control hosts. KJ015 was transfected into GS KO1, GS KO2, CHO-K1 cells by exactly the same method. 48hrs after transfection, 25μM MSX was added as selection pressure. After 2 weeks of static culture, clones grew. The number of clones and the 25 clones with the highest antibody expression at 24hr were compared. The results are shown in Table 3. The differences in the number of clones grown from the three are relatively small, and the expression levels of GS KO1 and GS KO2 host clones are obviously higher.

[0092] table 3

[0093]

[0094]

[0095] The cells with better expression were expanded and cultured, and the expression products were collected, and the quality of expressed antibodies was analyzed using IEC as a key quality indicator. The results s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of cell and gene engineering, genetic modification and therapeutic recombinant protein industrial production, and particularly relates to GS (glutamine synthetase) gene specific identification crRNA and application thereof. DNA (deoxyribonucleic acid) sequences identified by the GS gene specific identification crRNA are selectively DNA sequences shown as one of sequences SEQ ID NO.1-SEQ ID NO.8. The GS gene specific identification crRNA and the application have the advantages that GS genes of diversified cells can be specifically identified by the GS gene specific identification crRNA, the GS gene specific identification crRNA is wide in applicability, and integral procedures can be implemented easily and efficiently; the target protein expression quantities of cells without the GS genes can be greatly increased on the basis of imported exogenous carriers as compared with wild host cells, and accordingly required-to-be-inputted labor, material resources and financial resources for screening protein expression cell strains can be reduced; the GS genes are knocked out, and accordingly the industrial production cost can be reduced; the cells without the GS are used as host target gene expression cells, other chemical substances can be omitted in procedures for producing the cells, and accordingly the production safety can be improved.

Description

Technical field [0001] The invention belongs to the field of cell genetic engineering, genetic modification and industrial production of therapeutic recombinant proteins, and specifically relates to crRNA that specifically recognizes GS genes and applications thereof. Background technique [0002] Mammalian cells are currently the main tool for the production of complex protein drugs for treatment. Among them, Chinese Hamster Ovary Cells (CHO) are the most commonly used host cells and have been widely used in industrial production. In the protein expression system based on CHO cells, Dihydrofolate Reductase (DHFR) and Glutamine Synthetase (GS) are the two most commonly used selection genes. Among them, the GS system is gradually becoming the most widely used expression screening system because of its ease of use and stability. GS is a critical enzyme in the synthesis pathway of L-glutamine. Its absence will make the cell unable to synthesize L-glutamine by itself, so it needs to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/85C12N15/12
CPCC12N15/113C12N15/85C12N2015/8518C12N2800/107C12N2810/85
Inventor 徐云霞王征
Owner 苏州晟济药业有限公司