Molecular marker for rice seed peel color gene Pb and application of molecular marker
A color gene and molecular marker technology, applied in the field of plant biology, can solve the problems of time-consuming detection, high cost, cumbersome CAPS labeling operation, etc., and achieve the effects of fast typing, easy operation, and short amplification fragments
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1 Primer Design and Amplified Fragment Analysis of Rice Pb Gene Molecular Marker
[0038] 1. Primer design
[0039] Through the sequence alignment of rice pericarp color gene Pb alleles in purple and white pericarp varieties, the GT deletion site in exon 7 of Pb in purple and white pericarp varieties was analyzed. Design the primer combination according to the sequence upstream and downstream of the GT deletion site:
[0040] PbF:AGCGACGACGACACCGACG, (SEQ ID NO.1)
[0041] PbR1: ATGCCTGCACCGAGAGGATCCA, (SEQ ID NO. 2) and
[0042] PbR2: GTTGATGCCTGCACCGAGAGGACAT (SEQ ID NO.3) (see figure 1 ).
[0043] 2. Analysis of amplified fragments
[0044] When the above primer combination is used to amplify the rice peel color gene Pb, a 173bp band, or a 173bp and a 179bp band can be amplified simultaneously from the purple peel material (with GT deletion genotype Pb). A 179bp band will be amplified from the white peel material (with wild genotype Pb). The nucleotide...
Embodiment 2
[0045] Embodiment 2 identifies the Pb genotype of rice varieties / lines with molecular markers of the present invention
[0046] 1. Identification method of rice peel color
[0047] Remove the chaff with a brown rice machine, observe and record the color of the peel of the brown rice with the naked eye.
[0048] 2. Extraction of rice genomic DNA
[0049] Heibaonuo, Zhonghaixiang 1, Xiangwanxian 12, 70489, 71647, 70363, 71536, Guanghong 2, w10, w12, w13, Buxuenuo, K13135, Guangye 188, F13108-4, etc. 15 Rice varieties / strains are used as materials, and rice genomic DNA is extracted by the CTAB method. The specific steps are as follows: take 3 cm long rice leaves, and extract them in 800 μL of extraction buffer [1.5% (w / v) CTAB, 1.05mol / L NaCl, 75mmol / L Tris-HCl (pH 8.0), 15mmol / L EDTA (pH 8.0)] and collected into a 1.5mL centrifuge tube. Water bath at 65°C for 30 minutes, and mix by inverting occasionally. Add 800 μL of chloroform:isoamyl alcohol (volume ratio 24:1), and mix...
Embodiment 3
[0057] Embodiment 3 Application of molecular markers of the present invention
[0058] 1. Rice materials F of rice varieties Heibaonuo and Zhonghaixiang 1 2 Generation of 61 individual plants.
[0059] 2. Extraction of Genomic DNA of Rice Genomic DNA of leaves was extracted at the seedling stage, and the specific method was the same as in Example 2.
[0060] 3. Refer to Example 2 for PCR amplification and product judgment criteria.
[0061] 4. Refer to Example 2 for the identification method of rice peel color.
[0062] 5. Results and analysis The molecular markers of Example 1 of the present invention (specific primer combination PbF, PbR1, and PbR2 obtained by PCR amplification) were used to detect 61 F in Heibaonuo and Zhonghaixiang No. 1 at the seedling stage. 2 The genotype of Pb in the offspring individual plants, found that 12 individual plants only amplified the 179bp band, 16 individual plants only amplified the 173bp band, and 33 individual plants simultaneously a...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap