Small-activating RNA, preparation method and applications thereof

A sense sequence and antisense sequence technology, applied in the application field of double-stranded small RNA in the field of RNA activation technology, can solve the problems of low saRNA design success rate and low RNA activation efficiency, etc.

Inactive Publication Date: 2016-10-19
PEKING UNION MEDICAL COLLEGE HOSPITAL CHINESE ACAD OF MEDICAL SCI
View PDF5 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In view of the low success rate of saRNA design and low RNA activation efficiency in the design and application of saRNA, this application provides a dsaRNA design method to improve the efficiency of RNA activation and expand the use of RNA activation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small-activating RNA, preparation method and applications thereof
  • Small-activating RNA, preparation method and applications thereof
  • Small-activating RNA, preparation method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Materials and methods

[0052] 1. Design of Dicer substrate saRNA (dsaRNA):

[0053] The selection of the target site of the dsaRNA of the present invention is based on the following principles: 1. The selected target sequence is the sense sequence of the gene; 2. The 5' end of the guide RNA strand (guide RNA strand) is combined with the 3' end of the target sequence; 3. The GC content of the target sequence is 40-65%; 4. Avoid the target sequence containing 4 or more consecutive base sequences; 5. The 3' end of the target sequence is less thermodynamically stable than the 5' end. 6. The selected target sites should avoid CpG islands and high GC regions.

[0054] In the gene promoter region, the sequence length of the designed target site is 19 to 25 bases. The selected gene promoter region is from 5000 bases upstream of the transcription start site to the base before the gene transcription start site.

[0055] Taking the p21 gene as an example, the human p21 (CDKN1A...

Embodiment 2

[0090] (1) Activation efficiency of saRNA shorter than 25 nucleotides

[0091]A dsRNA of 23 nucleotides in length was designed for the 6 sites of the p21 gene promoter. Named respectively: dsP21-1a, dsP21-2a, dsP21-3a, dsP21-4a, dsP21-5a, dsP21-6a. Its sequence is: dsP21-1a (sense sequence: SEQ ID NO: 30GCUCCAGGUGCUUCUGGGAGAGG, antisense sequence: SEQ ID NO: 31UCUCCCAGAAGCACCUGGAGCAC); dsP21-2a (sense sequence: SEQ ID NO: 32GUAUUAAUGUCAUCCCUCCUGATC, antisense sequence: SEQ ID NO dsP21-3a (sense sequence: SEQ ID NO: 34CCUGGAGAGUGCCAACUCAUUCU, antisense sequence: SEQ ID NO: 35AAUGAGUUGGCACUCUCCAGGAG); dsP21-4a (sense sequence: SEQ ID NO: 36GGAUCAGUGGGAAUAGAGGUGAT, antisense sequence: SEQ ID NO: 36GGAUCAGUGGGAAUAGAGGUGAT, antisense sequence: NO: 37CACCUCUAUUCCCACUGAUCCCT); dsP21-5a (sense sequence: SEQ ID NO: 38CCAGAUUUGUGGCUCACUUCGTG, antisense sequence: SEQ ID NO: 39CGAAGUGAGCCACAAAUCUGGCT); dsP21-6a (sense sequence: SEQ ID NO: 40UGCCAACUCAUUCUCCAAGUAAA, antisense sequence: S...

Embodiment 3

[0096] The dsaRNA designed according to the patent of the present invention can efficiently activate the expression of the pancreas-duodenum homeobox gene (PDX1). PDX1 gene is an important gene regulating islet function, and PDX1 can also promote the expression of insulin gene in non-β cells such as liver cells, which has important application value for the treatment of diabetes. We designed dsaRNA targeting different sites in the PDX1 gene promoter region. The deoxyribonucleotides in the dsaRNA sequence are indicated in lower case bold in the sequences shown below. dsaPDX1-1 (sense sequence is: SEQ ID NO: 54CACACUAUGUCCAUUAUCAAAUA ta, antisense sequence is: SEQ ID NO: 55UAUAUUUGAUAAUGGACAUAGUGUGUU); dsaPDX1-2 (sense sequence is: SEQ ID NO: 56CCGACAUCUUUGUGGCUGUGAACaa, antisense sequence is: SEQ ID NO: 57UUGUUCACAGCCACAAAGAUGUCGGUU); dsaPDX1-3 (sense sequence is: SEQ ID NO: 58GACCUAGAGAGCUGGGUCUGCAAac, antisense sequence is: SEQ ID NO: 59GUUUGCAGACCCAGCUCUCUAGGUCAG); dsaPDX1-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a small-activating RNA, which comprises a sense sequence containing 25-30 nucleotides and an antisense sequence containing 25-30 nucleotides, wherein at least 80% of the antisense sequence is complementary to the sense sequence, the sense sequence or antisense sequence contains the matching fragment having 19-25 nucleotides, and at least 80% of the sequence of the matching fragment is complementary to the fragment of the target gene regulation sequence. According to the present invention, the small-activating RNA adopted as the Dicer substrate can activate the gene expression at the transcriptional and epigenetic levels, effectively imitates the natural maturation process of the endogenous double-stranded small RNA, and effectively increases the efficiency of RNA activation.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to the application of double-stranded small RNA in the technical field of RNA activation. Background technique [0002] In 1998, Fire and Mello discovered that double-stranded small RNA molecules (dsRNA) can trigger an evolutionarily conserved gene expression silencing mechanism in the nematode elegans, which is called RNA interference (RNAi), and this small RNA molecule is called small Interfering RNA (siRNA). Because siRNA can specifically silence the expression of target genes, it is considered very promising to be developed as a new gene-targeted drug for treating diseases. RNA interference is triggered by endogenous dsRNA molecules or exogenously introduced siRNA. Endogenous dsRNA is formed from a longer single-stranded RNA that is processed by a protein called Dicer in the cell after forming a hairpin structure. RNA interference can also be triggered by extracellular introd...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/10A61K48/00A61K31/713A61P35/00
Inventor李龙承龙波郭丹
OwnerPEKING UNION MEDICAL COLLEGE HOSPITAL CHINESE ACAD OF MEDICAL SCI