Gene OsPTR10 for improving nitrogen utilization efficiency and yield of rice and applications of gene OsPTR10

A rice and gene technology, applied in the direction of genetic engineering, plant genetic improvement, application, etc., to achieve the effect of improving nitrogen absorption efficiency, increasing plant yield, and increasing yield

Active Publication Date: 2016-11-16
WUHAN INST OF BIOENG
View PDF0 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few reports on the research of NPF family members. The OsPTR10 gene disclosed in the present invention is a homologous gene of the rice NPF gene family

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene OsPTR10 for improving nitrogen utilization efficiency and yield of rice and applications of gene OsPTR10
  • Gene OsPTR10 for improving nitrogen utilization efficiency and yield of rice and applications of gene OsPTR10
  • Gene OsPTR10 for improving nitrogen utilization efficiency and yield of rice and applications of gene OsPTR10

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] [Example 1] Construction of Overexpression OsPTR10 Gene Plants

[0039] The RNA of rice Zhonghua 11 was extracted and reverse transcribed into cDNA, using

[0040] Primer F: ATGCCATATAAGTATGTACTA (Seq ID No: 3)

[0041] Primer R: TCAGTGCGAGTGCGGGACGGC (Seq ID No: 4)

[0042] After the cDNA of the OsPTR10 gene was amplified by PCR, it was connected into the pCAM1301 vector, and the pCAM1301 vector was constructed from Cambia Company to construct the overexpression vector OsPTR10-p1301 of the OsPTR10 gene, such as figure 1 shown. Using the genetic transformation method mediated by Agrobacterium EHA105, the overexpression vector was introduced into the normal rice variety Zhonghua 11.

[0043] After all the transgenic seedlings were obtained, they were transplanted into the frame with soil, watered and fertilized regularly, and when the seedlings grew about 10cm in height, they were planted in the field. The FP10 primer pair for detection is

[0044] F: GATGTTGGCGACC...

Embodiment 2

[0047] [Example 2] Construction of OsPTR10 gene interference plants and acquisition of OsPTR10 gene mutants

[0048] The cDNA of rice Zhonghua 11 was used with a primer pair:

[0049] F1: 5'ACTAGTCATCCCATCACTACAACC 3' (Seq ID No: 7)

[0050] R1: 5'GAGCTCGTATCCAAACGACGACAG 3' (Seq ID No:8)

[0051] F2: 5'GGTACCCATCCATCACTACAACC 3' (Seq ID No:9)

[0052] R2: 5'GGATCCGTATCCAAACGACGACAG 3' (Seq ID No: 10)

[0053] After the cDNA fragments of OsPTR10 gene were amplified by PCR, they were connected into the pTCK303 vector, which was donated by Zhongkang Laboratory, Institute of Botany, Chinese Academy of Sciences, and the interference vector OsPTR10-pTCK303 of OsPTR10 gene was constructed. Using the genetic transformation method mediated by Agrobacterium EHA105, the interference expression vector was introduced into the normal japonica rice variety Zhonghua 11, such as figure 2 shown.

[0054] Using the genetic transformation method mediated by Agrobacterium EHA105, the overex...

Embodiment 3

[0060] [Example 3] Identification of nitrogen use efficiency and yield indicators of transgenic plants and mutant plants

[0061] The number of tillers of the above-mentioned transgenic plants was counted, and it can be found that the three lines of the overexpressed plants of the OsPTR10 gene have more tillers than the control, while the three lines of the interference plants and the mutant plants have fewer tillers than the control, such as Figure 5 shown. Data were analyzed by SPSS software for analysis of variables (ANOVA), and Duncan's was used for significant difference analysis at the 0.05 level. Different groups of lowercase letters (such as a, b, c) indicate significant differences.

[0062] The leaves of the above plants were collected and the soluble protein content in the leaves was measured. It can be found that the soluble protein content of the leaves of the three strains of the overexpression plants was significantly higher than that of the control, while the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of plant genetic engineering, and provides a rice nitrogen transporter gene OsPTR10, wherein the protein sequence of the rice nitrogen transporter gene OsPTR10 is shown as SEQ ID No.1, and the cDNA sequence of the rice nitrogen transporter gene OsPTR10 is shown as SEQ ID No.2. According to the rice nitrogen transporter gene OsPTR10, through the excessive expression of the OsPTR10 gene, the normal efficiency in absorbing nitrogenous fertilizer of the rice is improved, the content of soluble protein of plants is increased, further, the tiller number is increased, the ear length and filling grain number are increased, and finally, the yield is improved; through the RNAi technology, the expression quantity of the OsPTR 10 gene is reduced, and the functions of the gene are verified in the OsPTR10 target gene mutant. The gene has the significant application values on the aspects of the statement on the influences of the nitrogen element on the growth and development of the plants and on the aspects of the efficient utilization for the nitrogen fertilizer of the rice and the improvement on the yield of the rice.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and specifically relates to a gene OsPTR10 for improving rice nitrogen utilization efficiency and yield and its application. Background technique [0002] China's rice planting area accounts for 20% of the world's total crop planting area, but nitrogen fertilizer application accounts for 37% of the world's total application amount; in 1995, China's nitrogen fertilizer production and use amount reached the first in the world, but nitrogen fertilizer use efficiency is low Low, the amount of nitrogen fertilizer application has increased by 20 times compared with 50 years ago. According to this trend, it is expected to triple again by 2050. Excessive application of nitrogen fertilizer will lead to ecological pollution such as eutrophication of water [Xu Guohua, Fan Xiaorong. Functional study of rice nitrate transporter genes OsNRT1.1a and OsNRT1.1b. Nanjing Agricultural University, 2011: 4-6]...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12Q1/68A01H5/00
CPCC07K14/415C12N15/8205C12N15/8261C12Q1/6895
Inventor方中明黄玮婷白根祥曾祺森黄德浩
OwnerWUHAN INST OF BIOENG