Supercharge Your Innovation With Domain-Expert AI Agents!

Method and primer for detecting ELA2 gene

A technology for sequencing primers and genes, applied in the fields of life science and biology, can solve the problems of increasing the degradation of molecular chaperones, the transcription of pro-apoptotic genes, cell apoptosis, etc., and achieves the effects of high detection difficulty, reduced cost and difficulty, and high cost.

Inactive Publication Date: 2016-12-14
WUHAN ADICON CLINICAL LAB
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Some experiments have shown that U037 cells are transfected with mutated ELA2 gene to induce UPR. Studies have shown that the cellular ER stress response caused by ELA2 mutation will trigger UPR, increase the transcription of molecular chaperones, ER-related degradation and pro-apoptotic genes, and eventually lead to apoptosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and primer for detecting ELA2 gene
  • Method and primer for detecting ELA2 gene
  • Method and primer for detecting ELA2 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] A primer for detecting the polymorphic mutation site of the ELA2 gene, the design of the primer is an amplification primer designed for the whole exon of ELA2, including:

[0056] The primers for amplifying the whole exon sequence of ELA2 gene, its base sequence is:

[0057]ELA2-1F: TGTAAAACGACGGCCAGTATCTGACATTTGAATGCGATTG

[0058] ELA2-1R: AACAGCTATGACCATGGCACAGACAGACCTGGACTTG

[0059] ELA2-2 / 3F: TGTAAAACGACGGCCAGTCGTGCCTCAGTTTCCTCATC

[0060] ELA2-2 / 3R: AACAGCTATGACCATGCGTTTCACAGAGGTGCAGAC

[0061] ELA2-4 / 5F: TGTAAAACGACGGCCAGTGGGGAGGGTCATCATCACTG

[0062] ELA2-4 / 5R: AACAGCTATGACCATGCATTTTCAACACCCAATCACA

[0063] A kit for detecting polymorphic mutation sites of ELA2 gene, comprising

[0064] (i) Blood DNA extraction reagents;

[0065] (ii) detection system PCR reaction solution;

[0066] (iii) Sequencing system reagents;

[0067] Among them, the tissue DNA extraction reagent can be purchased from commercial reagents such as Tiangen DNA extraction kit.

[006...

Embodiment 2

[0071] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):

[0072] (1) Extract tissue DNA from blood: 1) Extract 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inverting, and place at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12,000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed. 2) Add 20 μl proteinase K solution and mix well. 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap. 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap. 5) Add the solution and flocculent precipitate obtained in the previous step ...

Embodiment 3

[0098] Three cases of clinical samples (sample number 1-3) were taken according to the reagents and methods of Examples 1 and 2 to extract genomes, prepare reagents, amplify and sequence. Add 1 μl of each sample to the detection system PCR reaction solution. Electrophoresis results such as figure 2 As shown, it shows that the primers ELA2-1F / R, ELA2-2 / 3F / R, ELA2-4 / 5F / R of the present invention can effectively amplify blood samples, and the band is single.

[0099] The test results of sample 1 are as follows: image 3 , 4 , as shown in 5:

[0100] image 3 It shows the wild-type sequencing screenshot of ELA2 exon 1 of sample 1, indicating that exon 1 of sample 1 is not mutated.

[0101] Figure 4 It shows the wild-type sequencing screenshots of ELA2 exons 2 and 3 of sample 1, indicating that there are no mutations in exons 2 and 3 of sample 1.

[0102] Figure 5 It shows the wild-type sequencing screenshots of ELA2 exons 4 and 5 of sample 1, indicating that there are n...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and a method for detecting mutation of an ELA2 gene of a patient with congenital neutropenia. The primer comprises a primer which is used for amplifying the whole exon sequence of the ELA2 gene; the Sanger sequencing technology and a sequencing primer are adopted. According to the method and the primer, the mutation of the whole exon sequence of the ELA2 gene in the body of the patient with the congenital neutropenia can be detected rapidly. The detection result finished by the method and the primer is accurate, can assist in diagnosing the congenital neutropenia, and has an important reference meaning for early intervention, early treatment and antenatal diagnosis.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and particularly relates to a primer and a method for detecting ELA2 gene. Background technique [0002] Congenital neutropenia is a heterogeneous group of diseases, including severe congenital neutropenia (SCN), cyclic neutropenia (CN), reticular dysplasia, etc. disease. Recent studies have shown that the ELA2 gene plays an important role in neutropenia. In 1999, Horwitz et al. determined that the abnormal gene of CN was the ELANE / ELA2 gene on chromosome 19, and now it has been determined that almost all CN patients have mutations in the ELA2 gene. In 2000, Dale et al. found that most autosomal dominant SCN patients had mutations in the neutrophil elastase gene (ELANE / ELA2). [0003] The ELA2 gene is located at 19p13.3, consists of 5 exons, and is involved in encoding neutrophil elastase (NE). NE is a myeloid cell-specific serine protease, which is produced in the promyeloid sta...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6883C12Q2600/156
Inventor 林筱剑陈奕磊王淑一
Owner WUHAN ADICON CLINICAL LAB
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More