Method and primer for detecting ELA2 gene
A technology for sequencing primers and genes, applied in the fields of life science and biology, can solve the problems of increasing the degradation of molecular chaperones, the transcription of pro-apoptotic genes, cell apoptosis, etc., and achieves the effects of high detection difficulty, reduced cost and difficulty, and high cost.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] A primer for detecting the polymorphic mutation site of the ELA2 gene, the design of the primer is an amplification primer designed for the whole exon of ELA2, including:
[0056] The primers for amplifying the whole exon sequence of ELA2 gene, its base sequence is:
[0057]ELA2-1F: TGTAAAACGACGGCCAGTATCTGACATTTGAATGCGATTG
[0058] ELA2-1R: AACAGCTATGACCATGGCACAGACAGACCTGGACTTG
[0059] ELA2-2 / 3F: TGTAAAACGACGGCCAGTCGTGCCTCAGTTTCCTCATC
[0060] ELA2-2 / 3R: AACAGCTATGACCATGCGTTTCACAGAGGTGCAGAC
[0061] ELA2-4 / 5F: TGTAAAACGACGGCCAGTGGGGAGGGTCATCATCACTG
[0062] ELA2-4 / 5R: AACAGCTATGACCATGCATTTTCAACACCCAATCACA
[0063] A kit for detecting polymorphic mutation sites of ELA2 gene, comprising
[0064] (i) Blood DNA extraction reagents;
[0065] (ii) detection system PCR reaction solution;
[0066] (iii) Sequencing system reagents;
[0067] Among them, the tissue DNA extraction reagent can be purchased from commercial reagents such as Tiangen DNA extraction kit.
[006...
Embodiment 2
[0071] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):
[0072] (1) Extract tissue DNA from blood: 1) Extract 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inverting, and place at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12,000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed. 2) Add 20 μl proteinase K solution and mix well. 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap. 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap. 5) Add the solution and flocculent precipitate obtained in the previous step ...
Embodiment 3
[0098] Three cases of clinical samples (sample number 1-3) were taken according to the reagents and methods of Examples 1 and 2 to extract genomes, prepare reagents, amplify and sequence. Add 1 μl of each sample to the detection system PCR reaction solution. Electrophoresis results such as figure 2 As shown, it shows that the primers ELA2-1F / R, ELA2-2 / 3F / R, ELA2-4 / 5F / R of the present invention can effectively amplify blood samples, and the band is single.
[0099] The test results of sample 1 are as follows: image 3 , 4 , as shown in 5:
[0100] image 3 It shows the wild-type sequencing screenshot of ELA2 exon 1 of sample 1, indicating that exon 1 of sample 1 is not mutated.
[0101] Figure 4 It shows the wild-type sequencing screenshots of ELA2 exons 2 and 3 of sample 1, indicating that there are no mutations in exons 2 and 3 of sample 1.
[0102] Figure 5 It shows the wild-type sequencing screenshots of ELA2 exons 4 and 5 of sample 1, indicating that there are n...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com