Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of Cotton Cytochrome p450 CYP94C1 Gene in Resistance to Verticillium Wilt

A technology of P450CYP94C1, CYP94C1, applied in the field of genetic engineering, can solve complex problems

Active Publication Date: 2019-12-03
HENAN UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this nomenclature has some drawbacks, especially in plants, since gene duplication and recombination complicate a simple nomenclature, in which case family assignments are based on phylogeny

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Cotton Cytochrome p450 CYP94C1 Gene in Resistance to Verticillium Wilt
  • Application of Cotton Cytochrome p450 CYP94C1 Gene in Resistance to Verticillium Wilt
  • Application of Cotton Cytochrome p450 CYP94C1 Gene in Resistance to Verticillium Wilt

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Cotton cytochrome P450 CYP94C1 The gene is the basis of the present invention, so the cloning and obtaining process of the gene will be briefly introduced as follows.

[0052] 1. Design primers for PCR amplification

[0053] First, cotton grows for two weeks, and after two cotyledons grow, cotton RNA is extracted, reverse-transcribed into cDNA, and set aside; specifically:

[0054] Referring to the instruction manual, use the EASYspin Plus Plant RNA Rapid Extraction Kit from Aidlab to extract the total RNA of the sample; then perform reverse transcription to obtain cDNA, and the 20 μL reverse transcription system is designed as follows:

[0055] oligo(dT)18, 1 μL;

[0056] RNA, 2 μL;

[0057] RNA free H 2 O, 10 μL;

[0058] 5×buffer, 4 μL;

[0059] dNTPs, 1 μL;

[0060] MLV, 1 μL;

[0061] RNA inhibitor, 1 μL;

[0062] The reverse transcription program is: 65°C, 5 min, 4°C, 1 min, 42°C, 1 h, 85°C, 5 min.

[0063] Then, the primer sequences were designed as fol...

Embodiment 2

[0085] This embodiment mainly introduces that in cotton under the Verticillium dahliae induction and hormone induction mode GbCYP94C1 The changes in gene expression and related experimental procedures are briefly described as follows.

[0086] Cotton under the induction mode of Verticillium dahliae GbCYP94C1 Gene expression changes

[0087] First, germinate cotton seeds, specifically: under the condition of 25°C, soak the cotton seeds in water for 8-12 hours in an incubator, then place them in a petri dish to keep moisture and cultivate them for one day. 25°C, 16 hours of light, 8 hours of darkness); cotton seedlings were inoculated with Verticillium dahliae after three weeks of growth;

[0088] Four days before the cotton seedlings were inoculated with Verticillium dahliae, prepare the Verticillium dahliae infection solution, specifically: Shake the Verticillium dahliae in culture medium (25°C, 150 rpm), filter the bacteria with gauze after four days of cultivation solut...

Embodiment 3

[0114] for further study GbCYP94C1 The relationship between the gene and Verticillium wilt, the inventor used the VIGS technology to analyze the GbCYP94C1 The gene was silenced, and the relevant experimental procedures are described below.

[0115] First, the construction contains GbCYP94C1 gene VIGS vector

[0116] Primers were designed as follows:

[0117] P450-VIGS-F: CCGGAATTCTTAATTGAGACAAGAGCTTG,

[0118] P450-VIGS-R: CGGGGTACCTTTATCAGGAAGAGAAAGAC;

[0119] First the TRV2 empty vector and PCR amplification obtained in embodiment 1 GbCYP94 The C1 gene sequence fragment was double-digested with EcoRI and KpnI enzymes respectively, and the 50 μL restriction enzyme digestion system was designed as follows:

[0120] EcoRI, 2 μL;

[0121] KpnI, 2 μL;

[0122] 10×Buffer, 5 μL;

[0123] TRV2 empty load (or amplified fragment), 41 μL;

[0124] Enzyme digestion at 37°C for 3 h;

[0125] After the double enzyme digestion, perform agarose gel electrophoresis; and use t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering and particularly relates to application of a cotton cytochrome P450 CYP94C1 gene to verticillium wilt resistance. The GbCYP94C1 gene is associated with verticillium wilt resistance of plants. When the plants are infected by verticillium dahliae, the gene expression quantity is evidently reduced; after treatment with part types of hormones, the gene expression quantity is increased evidently; after the gene is silenced, verticillium wilt resistance of the plants is improved; after overexpression of the gene, the plants are more sensitive in infection of verticillium dahliae. On the basis of the characteristics, by culturing or screening of CYP94C1 gene silenced plants, references can be provided for acquisition of new varieties of plants excellent in verticillium wilt resistance, and high application value in new plant variety culture is achieved.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to cotton cytochrome P450 CYP94C1 Patent application for the application of genes in Verticillium wilt resistance. Background technique [0002] Among the signaling pathways for plants to fight against pathogens, there are mainly two signaling pathways: one is the recognition of microbial / pathogen-associated molecular patterns (MAMP); the other is the regulation of plant hormone signaling pathways, mainly including salicylic acid (SA) signaling pathway, jasmonic acid (JA) signaling pathway and ethylene (ET) signaling pathway. Microbe / pathogen-associated molecular pattern recognition (microbe / pathogen-associated molecular patterns, MAMPs) is the innate immune defense system of plants, and its recognition is regulated by membrane-anchored pattern recognition receptors (PRRs). body. In the regulation of plant hormone signaling pathways, plant defense against the invasion...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/56A01H5/00A01H6/20A01H6/60
CPCC12N9/0081C12N15/8282C12Y114/15006
Inventor 蔡应繁周克学龙璐王微娜孙全高巍张骁宋纯鹏
Owner HENAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com