Swine fever oral attenuated freezing-dry vaccine and preparation method thereof and freeze-drying protective agent

A technology of freeze-dried protective agent and attenuated vaccine, which is applied in the field of oral attenuated freeze-dried vaccine for swine fever and freeze-dried protective agent, can solve the problems of increasing the difficulty of screening freeze-dried protective agent, and avoid the shrinkage and activity reduction of freeze-dried products. loss of protective activity

Inactive Publication Date: 2017-01-11
SHANGHAI ACAD OF AGRI SCI
View PDF9 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] Generally, the addition of mucosal immune adjuvants will increase the difficulty of screening lyoprotectants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Swine fever oral attenuated freezing-dry vaccine and preparation method thereof and freeze-drying protective agent
  • Swine fever oral attenuated freezing-dry vaccine and preparation method thereof and freeze-drying protective agent
  • Swine fever oral attenuated freezing-dry vaccine and preparation method thereof and freeze-drying protective agent

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0053] The preparation method and evaluation of oral attenuated freeze-dried vaccine for classical swine fever include:

[0054] 1. Primer design and synthesis

[0055] According to the CSFV E2 gene sequence, a pair of PCR detection primers were designed and synthesized. The size of the PCR product is 287bp. The specific sequence is as follows:

[0056] CSFV-F1:CAGGTATGCGATCTCGTCAACCA

[0057] CSFV-R1: GGGCACAGCCCAAATCCGAAGT

[0058] According to the mouse IFN-γ and IL-4 genes, a pair of fluorescent quantitative PCR primers for IFN-γ and IL-4 were designed and synthesized respectively. The primers were synthesized by Huada Gene Technology Service Company. The specific sequences are as follows:

[0059] IFN-γ-1: CCATCGGCTGACCTAGAGAA

[0060] IFN-γ-2: GATGCAGTGTGTAGCGTTCA

[0061] IL-4-1: GGTCTCAACCCCCAGCTAGT

[0062] IL-4-2: GCCGATGATCTCTCTCTCAAGTGAT

[0063] 2. Isolation and identification of CSFV

[0064] Use PK15 cells to proliferate CSFV. When the confluence of PK15 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a swine fever oral attenuated freezing-dry vaccine and a preparation method thereof and a freeze-drying protective agent, the swine fever oral attenuated freezing-dry vaccine includes antigen swine fever virus, a mucosal adjuvant and the freeze-drying protective agent, the freeze-drying protective agent includes 1-3% of gelatin, 1-3% of glycine and balance of water, the swine fever oral attenuated freezing-dry vaccine can well protect the activity of CSFV (Classical Swine Fever Virus), reduces live virus loss, can induce higher levels of IgG and IgA antibodies in oral immunization tests of mice, can promote expression of type I interferon in thymus and spleen, has the effect of protecting antigen activity and improving oral swine fever antigen immune efficiency, and can be used as a swine fever oral vaccine protective agent for industry development.

Description

technical field [0001] The invention belongs to the field of freeze-dried vaccines, and more specifically relates to an oral attenuated freeze-dried vaccine for swine fever, a preparation method thereof and a freeze-dried protective agent. Background technique [0002] Freeze-dried vaccines are mainly composed of antigens and freeze-dried protective agents. Antigens can include proteins, viruses, bacteria, etc. At present, the market application of veterinary freeze-dried vaccines is relatively common. Although freeze-dried vaccines have the advantages of convenient storage and centralized mass production, there are still some problems in the freeze-drying process or freeze-drying effect, which restricts the development of freeze-dried vaccines. The inactivation of virus particles or bacteria during antigen preservation and vaccine freeze-drying is one of the important factors restricting the quality of vaccines. [0003] In order to maintain the immune reactivity of virus...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/39A61K39/187A61K47/42A61K47/18A61P31/14
Inventor刘惠莉陶洁饶柏钟
OwnerSHANGHAI ACAD OF AGRI SCI