Recombinant herpes simplex virus hsv-htertp_icp4_lungca-gfp and diagnostic kit

A herpes simplex virus, virus genome technology, applied in the direction of recombinant DNA technology, virus, virus peptide, etc., can solve the problem of low virus reproduction titer

Active Publication Date: 2020-02-18
重庆宇珩生物科技有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The present invention aims to solve the defect of low reproductive titer of existing viruses, and provides a recombinant herpes simplex virus HSV-hTERTp_ICP4_LungCA-GFP, which has selective high titer fecundity, and the virus has a stable reproductive titer in lung cancer cells. 10 6 above

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant herpes simplex virus hsv-htertp_icp4_lungca-gfp and diagnostic kit
  • Recombinant herpes simplex virus hsv-htertp_icp4_lungca-gfp and diagnostic kit
  • Recombinant herpes simplex virus hsv-htertp_icp4_lungca-gfp and diagnostic kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] A preparation method of recombinant herpes simplex virus HSV-hTERTp_ICP4_LungCA-GFP, comprising the following steps:

[0085]1) Replace the ICP4 gene promoter in the herpes simplex virus containing the ICP4 gene with the human telomerase reverse transcriptase promoter hTERTp to construct the recombinant herpes simplex virus HSV-hTERTp_ICP4:

[0086] (1) Construction of shuttle plasmids pICP4del-hTERTp_ICP4 and pICP4del-eGFP

[0087] a. Cultivate the herpes simplex virus containing ICP4 gene with BHK cells, and purify its genomic DNA;

[0088] b. Amplify the flanking sequence upstream of the ICP4 gene: with the viral genome DNA obtained in step a) as a template, use the following ICP4USf forward primer and ICP4USr reverse primer:

[0089] ICP4USf forward primer: ccctccagacgcaccggagtcggggg,

[0090] ICP4USr reverse primer: aagtcgactctagaggatcgatctctgacctgagattggcggcactgaggta

[0091] Amplify the upstream flanking sequence of the ICP4 gene;

[0092] c. Amplify the down...

Embodiment 2

[0143] Example 2 HSV_LungCA-GFP selectively propagates and produces high-titer virus in lung cancer cells:

[0144] HSV_LungCA-GFP was used to infect lung cancer cells (A549, PG), liver cancer cells (HepG2, HuH7), prostate cancer cells PC-3, gastric cancer cells BGC823, colon cancer cells HT-29, human erythroleukemia cells TF- 1. Lymphoma cell U937, breast cancer cell MD-MB-231, pharyngeal squamous cell carcinoma cell Fadu, and melanoma cell A375 were tested for virus titer at 6, 12, 24, 48, and 72 hours. The results are shown in Table 1. Experimental data show that HSV_LungCA-GFP has the best effect on infecting lung cancer cells, and the virus reproduction titer after 24 hours or later is significantly higher (more than 2 logarithms) than that of other cancer cells that can reproduce the virus.

[0145]

Embodiment 3

[0146] Example 3 HSV_LungCA-GFP produces a higher titer of virus in lung cancer cells than HSV_ICP4

[0147] HSV_LungCA and HSV_ICP4 were respectively infected with lung cancer cells A549, PG, and NCI-H1755 at MOI=0.01, and the virus titers were detected at 6, 12, 24, 48, and 72 hours. see results Figure 1-2 . Experimental data showed that HSV_LungCA infected three types of lung cancer cells, and the viral reproduction titers reached 10 after 24 hours. 6 Above, although HSV_ICP4 can reproduce in three kinds of lung cancer cells, but the virus titer is low, the peak value is only 10 4 . The two viruses infected lung cancer cells, and their reproductive titers differed by 2 logarithms.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant herpes simplex virus HSV-hTERTp_ICP4_LungCA-GFP and a corresponding diagnostic reagent kit. DNA (deoxyribonucleic acid) fragments with the lengths of 25 bp are inserted in spaces between telomerase reverse transcriptase promoters on genomes of the virus and ICP4 (infected cell protein 4) genes, GFP (green fluorescent protein) expression cassettes are inserted in ICP34.5 sites, and sequences of the DNA fragments are AGCAGGACCTCGCCCTTGGGACGAC. The recombinant herpes simplex virus and the diagnostic reagent kit have the advantages that the virus is selectively high in titer reproductive capacity, and the lung cancer cell reproduction titer of the virus is stabilized and is higher than 10<6>; synthesized random short nucleotide sequences and the genomes of the virus HSV1-hTERTp_ICP4 are subjected to site-specific recombination (between hTERTp and ICP4); the short sequences are changed, accordingly, the reproduction titer of the virus can be improved, different viruses can be selectively high in titer reproduction for different types of tumor cells, for example, certain viruses in lung cancer cells are good in reproduction, certain viruses in liver cancer cells are high in titer, and the like.

Description

technical field [0001] The invention relates to a recombinant herpes simplex virus, in particular to a recombinant herpes simplex virus HSV-hTERTp_ICP4_LungCA-GFP and a corresponding diagnostic kit. Background technique [0002] Telomere is a special structure at the end of eukaryotic chromosomes. Its function is to maintain the stability of chromosome structure, including preventing fusion of chromosome ends, protecting chromosome structure genes and avoiding loss of genetic information during replication. Telomerase is a reverse transcriptase composed of small molecule RNA and protein, which can use its own RNA as a template to synthesize telomere DNA and make up for the telomere that gradually shortens with cell mitosis. It has three main components: human telomerase RNA (human telomerase RNA, hTR), telomerase-associated protein (telomerase-associated protein, TP1 / TLP1), human telomerase reverse transcriptase (human telomerase reverse transcriptase, hTERT ). Telomerase ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N7/01C12N15/65C12Q1/70C12Q1/06G01N15/14C12R1/93
CPCC07K14/005C12N7/00C12N15/65C12N2710/16621C12N2710/16622G01N15/14
Inventor谷明张婧
Owner重庆宇珩生物科技有限公司