A method for detecting gene hotspot mutations

A gene and hotspot technology, applied in the detection of gene hotspot mutations, genetic engineering and medical diagnosis, can solve the problems of white colonies of recombinant bacteria, bacteria that cannot complete α complementation, and cannot form β-galactosidase, etc.

Inactive Publication Date: 2019-10-15
NANHUA UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, when the foreign DNA is inserted into the plasmid at the multiple cloning site in the α-peptide coding sequence, because the reading frame of the α-peptide is destroyed, the α-peptide encoded by it is inactive, and the bacteria where the recombinant is located cannot complete the α-peptide. Complementary, unable to form active β-galactosidase, resulting in the formation of white colonies in recombinant bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for detecting gene hotspot mutations
  • A method for detecting gene hotspot mutations
  • A method for detecting gene hotspot mutations

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] 1. KRAS gene codon 12 hotspot mutation and corresponding wild sequence plasmid construction

[0066] 1.1 The gene sequence containing the KRAS gene hotspot mutation is shown in Seq No1.

[0067]Primer a TAGCCAAGCTTTGACTGCATACAAACTTGT, as shown in Seq No 2;

[0068] Primer d CGTCAGGATCCTTGGACCATATTCGTCCACA, shown in Seq No3.

[0069] Using the human blood genome as a template, PCR was performed with primers a and d to construct a wild template.

[0070]

[0071] The above system was reacted on the PCR instrument according to the following procedure: pre-denaturation at 95°C for 5 minutes, followed by a three-step cycle (95°C-15s, 58°C-15s, 72°C-15s, a total of 30 cycles), and finally 72°C-1min. Take 5 μL of the reaction solution for electrophoresis on agarose gel, such as figure 2 Shown: Lane 1 is a 100bp DNA marker; lanes 2 and 3 are wild-type PCR products.

[0072] The PCR product was purified, then connected to the PMD-19T plasmid, and finally transformed into...

Embodiment 2

[0125] 1. The 13th codon hotspot mutation of the KRAS gene and the corresponding wild sequence plasmid construction are the same as above, and the sequences of the selected intermediate primers primers b' and c' are as follows:

[0126] b': ACGTCACCAGCTCCAACTA, as shown in Seq No.8;

[0127] c':TTGGAGCTGGTGACGTAGG, as shown in Seq No.9.

[0128] 2. PCR amplification of the wild and gene fragments containing the 13th codon mutation

[0129] 2.1 Primer g: AGACATCGTAGGTAGTGACATAGCCAAGCTTTGACTGCATAC, as shown in Seq No.10;

[0130] Primer h: AAGGGATCCTTGGACCATATTCGTCCACAAAATGATTCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTAGG, as shown in Seq No.11.

[0131] The PCR amplification system is as follows:

[0132] -

[0133]

[0134]The above system was reacted in the PCR instrument according to the following procedure: pre-denaturation at 95°C for 5 minutes, followed by three-step cycles (30 cycles of 95°C-15s, 58°C-15s, and 72°C-15s), and finally 72°C-1min.

[0135] The templates were ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Name: a detection method of gene hot-spot mutation. Abstract: the detection method provided by the invention, by conducting restriction enzyme digestion on a wild sequence in vitro and by conducting treatment, which is not good for a ligation reaction, at the end of an incision, sub-clone an in-vitro amplification fragment, and then implements sequencing analysis on a colony formed by cloning. The detection method provided by the invention is conducive to the formation of the colony from mutant genes, while the capacity of a wild gene fragment to form a colony declines due to the restriction enzyme reaction and the ligation inhibiting treatment. The detection method provided by the invention has an application value in the aspect of analyzing gene mutation of a biological specimen which is low in mutant gene content.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the fields of molecular biology and clinical laboratory medicine, to genetic engineering and medical diagnosis, and in particular to a method for detecting gene hotspot mutations. Background technique [0002] The occurrence and development of tumors are related to gene mutations, including hereditary gene mutations and acquired somatic gene mutations. At present, it has been shown that there are hot spot mutations in a variety of genes, and their occurrence frequency is relatively high, which is not only related to the occurrence and development of a variety of tumors, but also closely related to the choice of tumor treatment. Currently, commonly used analysis methods for gene mutations include direct sequencing analysis, site-specific primer amplification, and PCR product melting point curve analysis. These technologies have their own advantages and disadvantages, but in the field...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6858
Inventor周翠兰张安迪彭翠英张佳郭紫芬肖莉李文刘璇李凯
OwnerNANHUA UNIV