Application of Mincle and inhibitor thereof in hepatic ischemia reperfusion injuries

A technology for reperfusion injury and liver ischemia, applied in the field of gene function and application, can solve the problem of inability to activate the Mincle gene, and achieve the effect of worsening liver ischemia-reperfusion injury

Inactive Publication Date: 2017-02-22
WUHAN UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Inflammatory factors such as LPS and IL-6 and NF-IL-6 transcription factors in the mitogen-activated kinase (MAPK) pathway can both up-regulate the transcription of Mincle gene on the surface of macrophages, but the above-mentioned inflammatory factors cannot activate NF-IL-6 Transcription of the Mincle gene in gene-deficient mice [3] , which shows that the activation of TLR4 by LPS and other inflammatory factors can affect the expression of Mincle gene through the NF-IL-6 transcription factor in the MAPK pathway.
However, the role of Mincle gene in liver ischemia-reperfusion injury has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Mincle and inhibitor thereof in hepatic ischemia reperfusion injuries
  • Application of Mincle and inhibitor thereof in hepatic ischemia reperfusion injuries
  • Application of Mincle and inhibitor thereof in hepatic ischemia reperfusion injuries

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Construction of Hepatocyte-specific Mincle Gene Knockout Mice and Mincle Transgenic Mice

[0036] (1) Construction of hepatocyte-specific Mincle gene knockout mice (for the construction strategy, see figure 1 A)

[0037] According to the information of the Mincle gene, CRISPR Design was used to design a CRISPR targeting site in intron 2 and 4 respectively. The target sequences are:

[0038] Mincle-sRNA1: CCTAATGATAGTGGTCTGAG AGG;

[0039] Mincle-sRNA2: TGAGGGCAAACATCTAATAC AGG.

[0040] In addition, a donor vector (Donor Vector) for homology repair was designed, which included homology arms on both sides, exons 3 and 4 in the middle, and two loxp sequences in the same direction.

[0041] 1) Construction of targeting vector: The two primers corresponding to sgRNA1 and sgRNA2 were fused into double-stranded DNA, and then ligated into pUC57-sgRNA (Addgene 51132) vector treated with restriction endonuclease BsaI with T4 DNA ligase. There is a T7 promoter upst...

Embodiment 2

[0062] Example 2 Obtaining of mouse liver ischemia-reperfusion injury model (ischemia / reperfusion injury, I / R)

[0063] (1) Grouping of experimental animals: male C57BL / 6 strain wild-type mice, hepatocyte-specific Mincle gene knockout mice, Mincle transgenic mice, and non-transgenic mice. Perfusion (I / R) model. They were randomly divided into 8 groups: C57BL / 6J strain wild-type mice sham operation group (WT Sham) and I / R operation group (WT I / R), Mincle gene knockout mouse sham operation group (KO Sham) and I / R operation group. R operation group (KO I / R), non-transgenic mouse sham operation group (NTG Sham) and I / R operation group (NTG I / R), liver cell-specific Mincle transgenic mouse sham operation group (TG Sham) and I / R surgery group (TG I / R).

[0064] (2) I / R model operation of liver ischemia / reperfusion injury (using non-invasive vascular clips to clamp the portal vein and hepatic artery in the middle lobe and left lobe, so that about 70% of the liver ischemia) operatio...

Embodiment 3

[0070] The measurement of embodiment 3 hepatic necrosis area and liver function index (AST, ALT)

[0071] The evaluation indicators of the severity of liver ischemia-reperfusion injury mainly include the area of ​​liver necrosis and liver function indicators (AST, ALT), all of which are positively correlated with the severity of liver ischemia-reperfusion injury.

[0072] (1) Take materials

[0073] Mice in the sham operation group (Sham) and the ischemia / reperfusion group were collected at 1 h, 3 h, 6 h, and 24 h after operation, and sacrificed by cervical dislocation, and 1 mL of blood was collected from the inferior vena cava immediately, and the serum was separated. At the same time, the left lobe of the liver in the ischemic area with a size of about 1.5cm×1cm×0.2cm was fixed in 10% neutral formalin for 24 hours, dehydrated, embedded, paraffin-sectioned, and HE stained.

[0074] Separation of serum: the EP tube where the blood was collected was left at room temperature f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of Mincle and an inhibitor thereof in hepatic ischemia reperfusion injuries, and belongs to the function and application field of genes. A hepatic cell specific Mincle gene knockout mouse and a Mincle transgenic mouse as experimental subjects, the functions of a Mincle gene are researched by virtue of a hepatic ischemia reperfusion injury model, and the Mincle gene is discovered to have an effect of exacerbating liver functions, so that the Mincle has the following applications: application of the Mincle serving as a drug target in screening medicines for preventing, relieving and / or treating the hepatic ischemia reperfusion injuries or protecting the liver functions, wherein screening the medicines for preventing, relieving and / or treating the hepatic ischemia reperfusion injuries or protecting the liver functions refers to screening the medicines capable of inhibiting Mincle expression, and application of the inhibitor of the Mincle in preparation of the medicines for preventing, relieving and / or treating the hepatic ischemia reperfusion injuries or protecting the liver functions.

Description

technical field [0001] The invention belongs to the field of gene function and application, relates to the application of Mincle and its inhibitors in liver ischemia-reperfusion injury, and specifically relates to the screening of Mincle as a drug target and the preparation of Mincle inhibitors in the prevention, alleviation and / or treatment of liver injury. Drug application in ischemia-reperfusion injury. Background technique [0002] The recovery of blood perfusion after a certain period of ischemia in the tissue will not only fail to quickly restore the function of the tissue and organ to normal, but will aggravate the inflammatory response, structural damage, and even serious dysfunction of the tissue and organ. This process is called ischemia-reperfusion. Injury (ischemia reperfusion injury, IRI). This kind of injury often occurs in medical procedures, such as organ transplantation, thrombolytic therapy, arterial bypass surgery, cardiopulmonary bypass heart surgery, hy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K45/00A61K49/00A61P9/10A61P1/16
CPCA61K45/00A61K49/0008
Inventor李红良张晓晶王晓占毛文哲
OwnerWUHAN UNIV