Modification method of mammal genome
A technology of mammals and modification methods, applied in biochemical equipment and methods, other methods of inserting foreign genetic materials, microorganisms, etc., to achieve the effect of increasing specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] The construction of embodiment 1 plasmid vector pcDNA-DN
[0021] Synthesize the DNA fragment DN (its sequence is shown in SEQ ID NO.1), and clone it into the multiple cloning site of the pcDNA3.1(+) vector (purchased from Invitrogen, product number V79020) by BamHI and EcoRI double enzyme digestion to obtain the plasmid vector pcDNA-DN. Through sequencing verification, it is confirmed that its sequence information is shown in SEQ ID NO.2, and the sequence of the forward sequencing primer pcDNA3.1-F used is shown in SEQ ID NO.3; the sequence of the reverse sequencing primer pcDNA3.1-R is shown in Shown in SEQ ID NO.4.
[0022] pcDNA3.1-F: CTAGAGAACCCACTGCTTAC, pcDNA3.1-R: TAGAAGGCACAGTCGAGG;
Embodiment 2
[0023] Example 2 Verification of the gene modification efficiency of the genome modification method in the human cell line 293T
[0024] Human cell line 293T was purchased from Shanghai Cell Bank, Chinese Academy of Sciences, catalog number: SCSP-502.
[0025] The first exon sequence of human MSH2 gene (its sequence is shown in SEQ ID NO.5):
[0026]
[0027] Select the 120-180bp segment of the above sequence as the target, design and synthesize two DNA oligonucleotides MSH2TF and MSH2TR (the sequence is shown in SEQ ID NO.6-7) for this target, these two oligonucleotides Complementary pairing with the antisense strand of the 131-153bp region of the above sequence and the sense strand of the 161-180bp region (except the last base at the 3' end), respectively, as follows:
[0028] MSH2TF: GGTGGAGCCGAAGGAGACGCTGC C , MSH2TR: AGCCGACCTCGGCCGCGCTC G ;
[0029] MSH2TF, MSH2TR and pcDNA-DN vector were transfected into human cell line 293T according to the ratio of 1:1:5. After...
Embodiment 3
[0031] Example 3 Verification of the gene modification efficiency of the genome modification method in the mouse cell line NIH / 3T3
[0032] The mouse cell line NIH / 3T3 was purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences, catalog number: SCSP-515.
[0033] The first exon sequence (its sequence is shown in SEQ ID NO.10) of mouse Tada1 gene is as follows:
[0034] 1 agagccgagc cgagccgagc cgagcggagc cgagccgagc cgagcggagc cgagccgagc
[0035] 61 cgagccgagc cgaaccgagc cgagccgagc cgaaccgagc cgagccgagc cgagtggaat
[0036] 121 cgagtcgagt cgagcctcca gcgtccggcg cgcaggcctt ccgccgcgtt gatctttcgg
[0037] 181 ttgctggtgg ccgtgggccg cgcggtctac ggtcgggctg aaagacgcgc gctgcaatgg
[0038]241 cgacctttgt gagcgagctg gaggcagcca agaagaactt gagcgaggcg ctgggggaca
[0039] 301acgtgaaaca
[0040] Select the 200-280bp segment of the above sequence as the target of genetic modification, design and synthesize two DNA oligonucleotides Tada1TF and Tada1TR (its sequence is shown in ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap