Nucleic acid amplification technology and application thereof in detection of mosquito-borne viruses

A nucleotide, dengue virus technology for recombinant DNA technology, resistance to vector-borne diseases, microorganism-based methods, etc.

Active Publication Date: 2017-03-22
CAPITALBIO CORP
View PDF4 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These viral infections can cause similar symptoms such as fever and arthralgia, and it is difficult to judge the type of viral infection from the clinical manifestations.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid amplification technology and application thereof in detection of mosquito-borne viruses
  • Nucleic acid amplification technology and application thereof in detection of mosquito-borne viruses
  • Nucleic acid amplification technology and application thereof in detection of mosquito-borne viruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0141] Embodiment 1, design and prepare each primer and probe

[0142] The primer pair used to detect Zika Virus (Zika Virus) consists of the following two primers (5'→3'):

[0143] ZIKV-F (Sequence 1 of the Sequence Listing): TGCATWGGAGTCAGCAA;

[0144] ZIKV-R (SEQ ID NO: 2 of the SEQUENCE LISTING): AATTCTAATACGACTCACTATAGGGAGATAGGATCTTACTCVGCCA.

[0145] The primer pair used to detect Chikungunya virus (Chikungunya virus) consists of the following two primers (5'→3'):

[0146] CHIKV-F (Sequence 3 of the Sequence Listing): CCGACTCAACCATCCTGGAT;

[0147] CHIKV-R (SEQ ID NO: 4 of the Sequence Listing): AATTCTAATACGACTCACTATAGGGAGAGGCARACGCAGTGGTACTTCCT.

[0148] The primer pair used to detect dengue virus type Ⅰ consists of the following two primers (5'→3'):

[0149] DENV1-F (Sequence 5 of the Sequence Listing): CAAAAGGAAGTCGTGCAATA;

[0150] DENV1-R (SEQ ID NO: 6 of the Sequence Listing): AATTCTAATACGACTCACTATAGGGAGACTGAGTGAATTCTCCTACTGAACC.

[0151] The primer pair used...

Embodiment 2

[0179] Embodiment 2, the preparation of mosquito-borne virus detection kit

[0180] 1. The composition of the kit

[0181] The kit consists of the following components (each component is individually packaged):

[0182] (1) The primer mixture consists of ZIKV-F, ZIKV-R, CHIKV-F, CHIKV-R, DENV1-F, DENV1-R, DENV2-F, DENV2-R, DENV3-F, DENV3-R, DENV4-F , DENV4-R and sterile water; in the primer mixture, the concentration of ZIKV-F is 0.2 μM, the concentration of ZIKV-R is 0.2 μM, the concentration of CHIKV-F is 0.15 μM, and the concentration of CHIKV-R is 0.15 μM , DENV1-F at a concentration of 0.2 μM, DENV1-R at a concentration of 0.2 μM, DENV2-F at a concentration of 0.15 μM, DENV2-R at a concentration of 0.15 μM, DENV3-F at a concentration of 0.3 μM, DENV3-R The concentration was 0.3 μM, the concentration of DENV4-F was 0.25 μM, and the concentration of DENV4-R was 0.25 μM.

[0183] (2) RT-RPA reaction buffer: TwistDx company, component of TABARTS01kit.

[0184] (3) Reactio...

Embodiment 3

[0206] Embodiment 3, the contrast of two kinds of nucleic acid amplification methods

[0207] 1. Preparation of standard products

[0208] RNA1 (single-stranded RNA molecule, Zika virus standard) shown in sequence 22 of the sequence listing was prepared. Dissolve RNA1 in sterile water, and then perform serial dilution with sterile water to obtain a concentration of 10 4 copies / μl, 10 3 copies / μl, 10 2 copies / μl, 10 copies / μl or 1 copies / μl of RNA1 dilution.

[0209] RNA2 (single-stranded RNA molecule, chikungunya virus standard) shown in sequence 23 of the sequence listing was prepared. Dissolve RNA2 in sterile water, and then perform serial dilution with sterile water to obtain a concentration of 10 4 copies / μl, 10 3 copies / μl, 10 2 copies / μl, 10 copies / μl or 1 copies / μl of RNA2 dilution.

[0210] RNA3 (single-stranded RNA molecule, dengue virus type I standard) shown in sequence 24 of the sequence listing was prepared. Dissolve RNA3 in sterile water, and then perfor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid amplification technology and an application thereof in detection of mosquito-borne viruses. The invention provides a method for detecting whether n kinds of target RNA sequences are contained in a sample to be detected or not. The method sequentially comprises the following steps: 1, extracting the total RNA of the sample to be detected; 2, carrying out reverse transcription recombinase polymerase amplification; and 3, carrying out recombinase polymerase amplification, wherein n is a natural number. The invention also provides a primer probe combination. The combination comprises primers and probes represented by sequence 1 to sequence 18 in a sequence table. A micro-fluidic chip, recombinase polymerase amplification and nucleic acid sequence dependent amplification are combined to effectively solve the problem of detection limit reduction of the micro-fluidic chip. The invention further provides a kit used for detecting the mosquito-borne viruses. The kit can simultaneously complete detection of six varieties of the mosquito-borne viruses one time, and has the advantages of high sensitivity, good specificity, fastness, good convenience, and wide application values.

Description

technical field [0001] The invention relates to a nucleic acid amplification technique and its application in mosquito-borne virus detection. Background technique [0002] Polymerase Chain Reaction (PCR) is currently the most commonly used detection technology for nucleic acid detection, and its detection results are accurate, specific, and reproducible. Multiplex PCR is a technology developed on the basis of PCR that can detect multiple target genes at the same time. Generally, there are at least two pairs or more than two pairs of primers in a multiplex PCR reaction system, which can simultaneously amplify multiple target genes in one reaction. Nucleic acid fragments are mainly used for simultaneous detection or identification of multiple pathogenic microorganisms. However, since there are multiple PCR primers in multiplex PCR, the primers are likely to interfere with each other. The more the multiplex, the more primers are included, the greater the probability of interfe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/6844C12Q1/6865C12Q1/701C12Q2565/629C12Q2563/107C12Q2521/107C12Q2521/507C12Q2537/143Y02A50/30
Inventor张岩盖伟邢婉丽宋翠丹程京
OwnerCAPITALBIO CORP