Anti-PD-L1 antibody as well as pharmaceutical composition and application of anti-PD-L1 antibody

A PD-L1, antibody technology, applied in the field of tumor therapy and molecular immunology, can solve the problem of tumor cell escape

Active Publication Date: 2017-05-24
BEIJING MABWORKS BIOTECH
View PDF7 Cites 26 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In most normal tissues, PD-L1 is not expressed, but when its expression on the surface of tumor cells in the tumor immune microenvironment increases, PD-L1 can bind to PD-1 on activated T cells and transmit negative Regulates signals that lead to apoptosis or immune anergy of tumor antigen-specific T cells, thereby suppressing the immune response and promoting the escape of tumor cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-PD-L1 antibody as well as pharmaceutical composition and application of anti-PD-L1 antibody
  • Anti-PD-L1 antibody as well as pharmaceutical composition and application of anti-PD-L1 antibody
  • Anti-PD-L1 antibody as well as pharmaceutical composition and application of anti-PD-L1 antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0095] Example 1: PD-L1 full antibody expression

[0096] Synthesis of Mil85-6 heavy chain variable region gene and light chain variable region gene. The gene sequence is as follows:

[0097] Nucleic acid sequence encoding Mil85-6 heavy chain variable region

[0098] GAGGTGCAGCTGGTGGAGAGCGGCGGCGGCCTGGTGCAGCCAGGCGGCAGCCTGAGACTGAGCTGCGCCGCCAGCGGCTTCACCTTCGCTGATAGCTGGATCCACTGGGTGAGACAGGCCCCTGGCAAGGGCCTGGAGTGGGTGGCCTGGATCAGCCCATTTGGCGGCTCTAATTACTACGCCGACAGCGTGAAGGGCAGATTCACCATCAGCGCCGACACCAGCAAGAACACCGCCTACCTGCAGATGAACAGCCTGAGAGCCGAGGACACCGCCGTGTACTACTGCGCCAGAAGACACTGGCCAGGCGGCTTCGACTACTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGC (SEQ ID NO: 9)

[0099] Nucleic acid sequence encoding Mil85-6 light chain variable region

[0100] GATATCCAGATGACCCAGAGCCCGAGCAGCCTGAGCGCGAGCGTGGGTGATCGCGTGACCATTACCTGCCGCGCGAGCCAGAGTATCGGTACCGCCCTGAATTGGTATCAGCAGAAACCGGGTAAAGCGCCGAAACTGTTAATTTATACGGCCAGCAGCCTGCAGTCTGGCGTGCCGTCGCGTTTTAGCGGCTCGGGTTCGGGCACCGATTTTACCCTGACCATCTCGAGCTTGCAGCCGGAGGACTTCGCCACCTACTATTGCCAGCAAGACAAC...

Embodiment 2

[0102] Example 2: Binding of whole antibody to PD-L1

[0103] Coat 5μg / ml PD-L1-Fc with PBS in a 96-well plate, incubate overnight at 4°C, discard the coating solution the next day, and wash three times with PBST, add 200μl blocking solution to each well, incubate at room temperature for 1h, PBST Wash three times, adjust the highest concentration of MIL85-6 antibody to 20μg / ml, and perform 5-fold dilution, make ten concentration gradients, add 100μl to each well, incubate for 1h at room temperature, wash three times with PBST, and add anti-Fab- HRP, 100μl per well, incubate at room temperature for 1h, wash each well four times, add TMB color developing solution, 100μl / well, develop color at room temperature, use 10% H 2 SO 4 Stop color development, 50μl / well, 450nm reading. Wherein, the used PD-L1-Fc can be prepared by a method known to those skilled in the art, for example, refer to the following steps:

[0104] The cDNA sequence of the extracellular region of the antigen PD-L1 ...

Embodiment 3

[0107] Example 3: Comparison of binding activity of whole antibodies

[0108] With Mil76 as a control (the sequence is referenced to Atezolizumab, and its expression and purification are obtained according to the expression and purification method of the MIL85-6 antibody), the affinity of the anti-PD-L1 antibody Mil85-6 obtained in the present invention is compared.

[0109] Coat 1μg / ml PD-L1-Fc with PBS in a 96-well plate, incubate overnight at 4°C, discard the coating solution the next day, and wash three times with PBST, add 200μl blocking solution to each well and incubate for 1h at room temperature. Wash three times with PBST, adjust the highest antibody concentration to 10μg / ml, and carry out 4-fold dilution, make 8 concentration gradients, add 100μl per well, incubate for 1h at room temperature, wash three times with PBST and add anti-Fab-HRP, 100μl per well, incubate for 1h at room temperature, wash four times, add TMB color developing solution, 100μl / well, develop color a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of oncotherapy and molecular immunology, and relates to an anti-PD-L1 antibody as well as a pharmaceutical composition and an application of the anti-PD-L1 antibody. Particularly, the invention relates to a monoclonal antibody or an antigen binding fragment of the monoclonal antibody, wherein a heavy chain variable region of the monoclonal antibody comprises a CDR, the amino acid sequence of the CDR is SEQ ID NO:1-3, and / or a light chain variable region of the monoclonal antibody comprises a CDR, and the amino acid sequence of the CDR is SEQ ID NO:4-6. The monoclonal antibody is specifically bound with PD-L1 well, specifically relieves immunosuppression of PD-1 on the organism, and activates the T iymphocyte.

Description

Technical field [0001] The present invention belongs to the field of tumor treatment and molecular immunology, and relates to an anti-PD-L1 antibody, a pharmaceutical composition thereof, and uses thereof. Specifically, the present invention relates to an anti-PD-L1 monoclonal antibody. Background technique [0002] Tumor immunotherapy is one of the most promising research directions in the current tumor treatment field. The preliminary clinical trial results show that its treatment efficiency is very high. The activation of initial T cells requires two signals, namely the antigen-specific signal provided by the combination of T cell antigen receptor (TCR) and the antigen peptide-MHC molecule complex on the DC, and the B7 costimulatory molecule and T on the DC The CD28 molecule on the cell binds to the costimulatory signal provided. Only dual-signal co-stimulation can effectively activate T cell response. If the second signal stimulus is absent, T cells will be clonally incompe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/28C12N15/13G01N33/68G01N33/577A61K39/395A61P35/00A61P35/02
CPCA61K2039/505A61K2039/507C07K16/2827C07K2317/565C07K2317/76C07K2317/92G01N33/577G01N33/68G01N2333/70532
Inventor王霞李锋张伯彦叶培刘慧芳李燕
OwnerBEIJING MABWORKS BIOTECH