Preparation method and applications of actinobacillus pleuropneumoniae-derived I-F type CRISPR-associated protein Csy4

A technology of porcine pleuropneumoniae and actinobacillus, applied in the field of gene editing and/or genome modification of organisms, and genetic engineering, can solve the problems of great differences in sequence homology among family members

Inactive Publication Date: 2017-05-31
NAT UNIV OF SINGAPORE SUZHOU RES INST
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the Cas6 protein family has the above-mentioned common structural basis, the sequence homology among its family members is extremely different. Therefore, it is particularly important to improve the information of the Cas6 family members
[0004] At present, it has been

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and applications of actinobacillus pleuropneumoniae-derived I-F type CRISPR-associated protein Csy4
  • Preparation method and applications of actinobacillus pleuropneumoniae-derived I-F type CRISPR-associated protein Csy4
  • Preparation method and applications of actinobacillus pleuropneumoniae-derived I-F type CRISPR-associated protein Csy4

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: Construction of the I-F CRISPR-related protein Csy4 expression vector of Actinobacillus pleuropneumoniae

[0046] The pET28b vector was double digested with NcoI and XhoI. Both ends of the artificially amplified Csy4 gene have primers F-Csy4:GGTTA CCCATGG CCAGTGAATTAACACATTACAT and R-Csy4:GGTTAC CTCGAG GAAATGTGGGACGGTTGCT. , and then use T4 ligase to connect the double-digested Csy4 gene PCR product with the linearized pET28b vector to obtain the pET28b-Csy4 recombinant plasmid.

Embodiment 2

[0047] Embodiment 2: Expression of pET28b-Csy4 recombinant plasmid in Escherichia coli

[0048]The pET28b-Csy4 recombinant plasmid was transformed into BL21(DE3) Escherichia coli, and the LB solid plate was coated. After overnight culture, pick a single colony in 100ml LB liquid medium, overnight at 37°C and 250rpm, use it as seeds for later use, and inoculate the seeds in shake flasks containing 2L LB medium for cultivation the next day until OD 600 0.6, add IPTG, the final concentration is 0.4mM, and induce for 14h at 20°C and 180rpm;

[0049] Wherein, 50ug / L kanamycin was added to both the LB solid plate and the LB medium;

[0050] Each 1 LLB medium component includes: 5g yeast powder, 10g peptone and 10g sodium chloride;

Embodiment 3

[0051] Embodiment 3: Purification of Csy4 protein

[0052] The cells after induction of expression were centrifuged at 5000rpm for 25min, discarded the supernatant, and resuspended with the lysate. The resuspended bacteria were crushed with a high-pressure homogenizer, centrifuged at 24,000 rpm for 1 h, and the supernatant was collected, purified with a Ni column, and then dialyzed to remove imidazole.

[0053] Such as figure 2 , image 3 As shown, after dialysis, the Csy4 protein was purified by molecular sieves to obtain a pure product, and dialysis reduced the salt concentration.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of genetic engineering, and relates to functions, a preparation method and applications of actinobacillus pleuropneumoniae (App)-derived I-F type CRISPR-associated protein Csy4. The preparation method comprises the following steps: recombining the actinobacillus pleuropneumoniae-derived Csy4 gene onto a pET28b carrier, and constructing a pET28b-Csy4 recombinant plasmid; and converting the pET28b-Csy4 recombinant plasmid into escherichia coli and inducing expression, breaking thalli after expression, centrifuging, and purifying by adopting affinity chromatography technology, so as to obtain Csy4 protein. The inventors find that the Csy4 protein and specific RNA have binding activity by adopting electrophoretic mobility shift assay (EMSA).

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to the field of gene editing and / or genome modification of organisms. specifically involves a [0002] Structure and function of a type I-F CRISPR-associated protein from Actinobacillus pleuropneumoniae. Background technique [0003] and β3' form a β-hairpin structure, and compared with the N-terminal domain, the two strands of the β-hairpin structure are longer; (3) GBE (groove- binding element) which mainly guides the major groove of crRNA and then recognizes each other with the base of this site. Although the Cas6 protein family has the above-mentioned common structural basis, the sequence homology among its family members is very different. Therefore, it is particularly important to improve the information of the Cas6 family members. [0004] At present, it has been reported that Cas6 is mainly derived from Pyrococcushorikoshii, Sulfolobudsolfataricus, Methanococcus maripalu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/22C12N15/55C12N15/70G01N27/447
CPCC12N9/22C12N15/70C12N2800/101G01N27/447
Inventor 殷波翟伟锋党梅
Owner NAT UNIV OF SINGAPORE SUZHOU RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap