Tyrosine phenol-lyase (TPL) mutant of fusobacterium nucleatum, gene, carrier, engineered bacteria strain, and applications of TPL mutant of fusobacterium nucleatum

A technology of Fusobacterium nucleatum and genetically engineered bacteria, applied in genetic engineering, lyase, carbon-carbon lyase, etc., can solve the problems of catalytic efficiency to be improved and achieve excellent catalytic performance

Active Publication Date: 2017-05-31
ZHEJIANG UNIV OF TECH
View PDF1 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Since catechol, one of the substrates catalyzed by TPL to synthesize levodopa, is not a natural substrate of the enzyme, its catalytic efficiency needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tyrosine phenol-lyase (TPL) mutant of fusobacterium nucleatum, gene, carrier, engineered bacteria strain, and applications of TPL mutant of fusobacterium nucleatum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Obtaining of TPL gene

[0034] The whole genome DNA of Fusobacterium nucleatum (F.nucleatum subsp.CGMCC 1.2526, purchased from China Industrial Microorganism Culture Collection Management Center) was extracted with a DNA extraction kit. Using the DNA as a template, the upstream primer (5'GCTGA GGATCC ATGAGATTTGAAGATTATCCAGC 3’ ) and downstream primer (5'GCATC CTCGAG TTATTTTTTTATTCCAAATCTAGC 3’ ) as primers for PCR amplification reaction. The amount of each component in the PCR reaction system (total volume: 50 μL): 10 μL of 5×PrimeSTARTM HS DNA polymerase Buffer, 4 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL of each upstream primer and downstream primer at a concentration of 50 μM, Genomic DNA 1 μL, PrimeSTARTM HS DNA polymerase 0.5 μL, nucleic acid-free water 32.5 μL. The PCR reaction conditions were as follows: pre-denaturation at 95°C for 1min, followed by a temperature cycle of 95°C for 10s, 56°C for 90s, and 72°C for 1...

Embodiment 2

[0035] Example 2 Error-prone PCR construction of TPL mutation library

[0036] Using the TPL gene obtained in Example 1 as a template, the mutant sequence was obtained by error-prone PCR amplification. Amplification primers are (5'GCTGA GGATCC ATGAGATTTGAAGATTATCCAGC 3’ ) and (5'GCATC CTCGAG TTATTTTTTTATTCCAAATCTAGC 3’) .

[0037] The amplification system is: 50μl reaction system:

[0038] 10xTaq polymerase buffer: 5μL;

[0039] Mg 2+ (25mM): 2-8μL;

[0040] Mmm 2+ (25mM): 2-8μL;

[0041] 10mM dNTP mixture (dATP, dCTP, dGTP and dTTP each 2.5mM) 4μ;

[0042] 1 μL each of the upstream primer and the downstream primer at a concentration of 50 μM,

[0043] DNA template: 1 μL;

[0044] Taq DNA polymerase: 10U;

[0045] Make up the system with double distilled water.

[0046] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 1min, followed by a temperature cycle of 95°C for 10s, 56°C for 90s, and 72°C for 1min, a total of 30 cycles, and finall...

Embodiment 3

[0047] Example 3 Screening of TPL mutant library

[0048] The screening of the TPL mutation library was as described in the literature (Choi, et al., Kor. J. Microbiol. 2006, 34:58-62). Using the enzyme before mutation as a reference, positive clones with improved activity were obtained through primary screening, which were further determined by liquid chromatography. After the first round of mutation, the mutant with the highest activity was obtained, and sequencing showed that the obtained mutant was E84K. Extract the plasmid containing the E84K mutant as a template, and perform the second round of error-prone PCR, as in Example 2, after transforming into Escherichia coli, and then screen the mutant library to obtain a mutant with improved activity compared with E84K, which is shown by sequencing. The mutant is double mutant E84K / T129I, the amino acid sequence of which is SEQ ID No.4, and the nucleotide sequence is SEQ ID No.3.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses tyrosine phenol-lyase (TPL) mutant of fusobacterium nucleatum, a gene, a carrier, an engineered bacteria strain, and applications of the TPL mutant of fusobacterium nucleatum in synthetizing levodopa. Compared with the wild type, the TPL mutant of fusobacterium nucleatum provided by the invention has the more excellent catalytic performance. The accumulated concentration in synthesizing levodopa of the TPL mutant of fusobacterium nucleatum achieves 140g / L or above, compared with that of the wild type, the accumulated concentration is improved by 17-25 %, and the optical purity is greater than 99.5%; the conversion rate of the substrate, namely, catechol achieves 99.8% or above, and compared with that of the wild type, the conversion rate is improved by 15-20 %.

Description

[0001] (1) Technical field [0002] The invention relates to a tyrosine phenol lyase (Tyrosine Phenol Lyase, TPL) mutant derived from Fusobacterium nucleatum, an encoding gene and its application in catalyzing the synthesis of L-DOPA. [0003] (2) Background technology [0004] Levodopa (β-3,4-dihydroxyphenyl-α-alanine, 3,4-dihydroxylphenylalanine-L-alanine, L-DOPA) is an important bioactive substance in living organisms. It can pass through the blood-brain barrier, reach the central nervous system, and be converted into dopamine under the action of decarboxylase in the body, thereby playing the role of treating Parkinson's syndrome. With the increasing pressure of life in modern society and the aggravation of population aging, the number of patients with Parkinson's disease is increasing day by day. [0005] The main methods of traditional preparation of levodopa include extraction from plants such as quinoa bean and cat bean and chemical asymmetric synthesis. Among them, th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/88C12N15/60C12N1/21C12P13/22C12R1/19
CPCC12N9/88C12P13/22C12Y401/99002
Inventor郑裕国郑仁朝汤晓玲冯沥琳朱杭芹
OwnerZHEJIANG UNIV OF TECH