Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of tyrosine phenol lyase mutant, engineering bacteria and application

A technology of tyrosine phenol and lyase, which is applied in the field of tyrosine phenol lyase mutants, can solve the problems of enzyme inactivation, enzyme and cell toxicity, etc., and achieve the effect of excellent catalytic performance

Active Publication Date: 2022-02-11
ZHEJIANG UNIV OF TECH
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the substrate catechol is not the natural substrate of the enzyme, its catalytic efficiency needs to be improved. On the other hand, high concentrations of catechol can cause toxicity to the enzyme and cells, and even irreversibly inactivate the enzyme. Ultimately inhibits levodopa synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of tyrosine phenol lyase mutant, engineering bacteria and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1, the acquisition of TPL gene

[0026] Extract the whole genome DNA of Fusobacterium nucleatum (F. nucleatum subsp.CGMCC 1.2526, purchased from China Industrial Microorganism Culture Collection Management Center) with a DNA extraction kit (purchased from Thermo Fisher Scientific Company), and use the DNA as a template, upstream The primer (5'TGTTAGCAGCCGGATCTCAGT3') and the downstream primer (5'GGAGATATACCATGCGCTTTGA3') were used as primers for PCR amplification. The amount of each component in the PCR reaction system (total volume 50 μL): 5×PrimeSTARTM HS DNA polymerase Buffer 10 μL, 10 mM dNTP mixture (dATP, dCTP, dGTP and dTTP each 2.5 mM) 4 μL, the concentration of 50 μM upstream primer, downstream primer 1 μL, 1 μL of genomic DNA, 0.5 μL of PrimeSTARTM HS DNA polymerase, 32.5 μL of nucleic acid-free water. The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 minutes, followed by a temperature cycle of 95°C for 1 minute, 55°C for ...

Embodiment 2

[0027] Embodiment 2, error-prone PCR construction TPL mutant library

[0028] Using the TPL gene obtained in Example 1 as a template, the mutant sequence was obtained by error-prone PCR amplification. The amplification primers are:

[0029] (5'TGTTAGCAGCCGGATCTCAGT3') and (5'GGAGATATACCATGCGCTTTGA3').

[0030] The amplification system is: 50μl reaction system:

[0031] 10×Taq polymerase buffer: 5 μL; Mg 2+ (25mM): 2-16μL; Mn 2+ (5mM): 2-20μL; 10mM dNTP mixture (dATP, dCTP, dGTP and dTTP each 2.5mM) 4μl; concentration of 50μM upstream primer, downstream primer 1μL each, DNA template: 1μL; Taq DNA polymerase: 0.5μL; Make up the system with double distilled water.

[0032] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 minutes, followed by a temperature cycle of 95°C for 1 minute, 55°C for 1 minute, and 72°C for 90 seconds, a total of 30 cycles, and finally an extension at 72°C for 10 minutes, with a termination temperature of 4°C. The PCR produ...

Embodiment 3

[0033] Embodiment 3, the screening of TPL mutant library

[0034] The TPL mutation library constructed in Example 2 was screened by salicylaldehyde spectrophotometry. The principle of color development is: under alkaline conditions, sodium pyruvate and salicylaldehyde will undergo Claisen-Schmidt (Claisen-Schmidt) reaction to generate a yellow compound, the color of which is directly proportional to the content of sodium pyruvate, and then measured by using a spectrophotometer to measure the absorbance of the reaction solution at a specific wavelength.

[0035] The specific reaction steps of color reaction are: in 1mL standard reaction system, add 100μL 250g / L NaOH aqueous solution, 40μL supernatant, 560μL ultrapure water, 20μL salicylaldehyde chromogenic solution in sequence, shake well and add 200μL 250g / L NaOH aqueous solution, 80 μL ultrapure water, after standing at room temperature for 2 hours, take 200 μL of the color reaction solution in a 96-well standard plate, measu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mutant of tyrosine phenol lyase and its application. The mutant is obtained by performing error-prone PCR single mutation on the 402nd or 409th amino acid sequence shown in SEQ ID NO: 2; Compared with the wild type, the tyrosine phenol lyase mutant provided by the invention has better catalytic performance. The TPL mutant synthesized levodopa with a cumulative concentration of up to 146 g / L, which was 25% to 45% higher than the wild type, and the optical purity was greater than 99.5%; the conversion rate of the substrate catechol reached more than 99.8%, which was higher than that of the wild type 15%‑20% improvement compared to other models.

Description

(1) Technical field [0001] The invention relates to a tyrosine phenol lyase mutant, an engineering bacterium and its application. (2) Background technology [0002] With the intensification of global aging, the increasing number of senile diseases is an unavoidable reality. Parkinson's disease is an senile disease that has gradually attracted public attention in recent years. It is a common chronic disease of the central nervous system. [0003] Dopamine is the main substance for the treatment of Parkinson's syndrome, but because it cannot reach the central nervous system through the blood-brain barrier, levodopa (β-3,4-dihydroxyphenyl-α-alanine, 3, 4-dihydroxyphenyl-L-alanine, L-DOPA) can pass through the blood-brain barrier, reach the central nervous system, and under the action of decarboxylase, convert it into dopamine, and then play the role of treating Parkinson's syndrome, so levodopa Drug of choice for the treatment of Parkinson's disease. Due to the increasing num...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/88C12N15/70C12N1/21C12P13/22C12R1/19
CPCC12N9/88C12Y401/99002C12P13/225C12N1/20
Inventor 郑仁朝王江平汤晓玲索慧郑裕国
Owner ZHEJIANG UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More