Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Tyrosine phenol lyase mutant, engineering bacterium and application of tyrosine phenol lyase mutant in catalytic synthesis of levodobar

A tyrosine phenol, levodopa technology, applied in the directions of lyase, carbon-carbon lyase, application, etc., can solve the problems of enzyme inactivation, enzyme and cytotoxicity, etc., and achieve the effect of excellent catalytic performance

Pending Publication Date: 2022-03-29
ZHEJIANG UNIV OF TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the substrate catechol is not the natural substrate of the enzyme, its catalytic efficiency needs to be improved. On the other hand, high concentrations of catechol can cause toxicity to the enzyme and cells, and even irreversibly inactivate the enzyme. Ultimately inhibits levodopa synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tyrosine phenol lyase mutant, engineering bacterium and application of tyrosine phenol lyase mutant in catalytic synthesis of levodobar

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1, the acquisition of TPL gene

[0026] Extract the whole genome DNA of Fusobacterium nucleatum (F. nucleatum subsp.CGMCC 1.2526, purchased from China Industrial Microorganism Culture Collection Management Center) with a DNA extraction kit (purchased from Thermo Fisher Scientific Company), and use the DNA as a template, upstream The primer (5'TGTTAGCAGCCGGATCTCAGT3') and the downstream primer (5'GGAGATATACCATGCGCTTTGA3') were used as primers for PCR amplification. Addition amount of each component of the PCR reaction system (total volume 50 μL): 5×PrimeSTARTM HS DNA polymerase Buffer 10 μL, 10 mM dNTP mixture (dATP, dCTP, dGTP and dTTP each 2.5 mM) 4 μL, 50 μM upstream primer and downstream primer 1 μL each , genomic DNA 1 μL, PrimeSTARTM HS DNA polymerase 0.5 μL, nucleic acid-free water 32.5 μL. The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 minutes, followed by a temperature cycle of 95°C for 1 minute, 55°C for 1 minute, and 72...

Embodiment 2

[0027] Embodiment 2, error-prone PCR construction TPL mutant library

[0028] Using the TPL gene obtained in Example 1 as a template, the mutant sequence was obtained by error-prone PCR amplification. The amplification primers are:

[0029] (5'TGTTAGCAGCCGGATCTCAGT3') and (5'GGAGATATACCATGCGCTTTGA3').

[0030] The amplification system is: 50μl reaction system:

[0031] 10×Taq polymerase buffer: 5 μL; Mg 2+ (25mM): 2-16μL; Mn 2+ (5mM): 2-20μL; 10mM dNTP mixture (dATP, dCTP, dGTP and dTTP each 2.5mM) 4μl; concentration of 50μM upstream primer, downstream primer 1μL each, DNA template: 1μL; Taq DNA polymerase: 0.5μL; Make up the system with double distilled water.

[0032] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 minutes, followed by a temperature cycle of 95°C for 1 minute, 55°C for 1 minute, and 72°C for 90 seconds, a total of 30 cycles, and finally an extension at 72°C for 10 minutes, with a termination temperature of 4°C. The PCR produ...

Embodiment 3

[0033] Embodiment 3, the screening of TPL mutant library

[0034] The TPL mutation library constructed in Example 2 was screened by salicylaldehyde spectrophotometry. The principle of color development is: under alkaline conditions, sodium pyruvate and salicylaldehyde will undergo Claisen-Schmidt (Claisen-Schmidt) reaction to generate a yellow compound, the color of which is directly proportional to the content of sodium pyruvate, and then measured by using a spectrophotometer to measure the absorbance of the reaction solution at a specific wavelength.

[0035] The specific reaction steps of color reaction are: in 1mL standard reaction system, add 100μL 250g / L NaOH aqueous solution, 40μL supernatant, 560μL ultrapure water, 20μL salicylaldehyde chromogenic solution in sequence, shake well and add 200μL 250g / L NaOH aqueous solution, 80 μL ultrapure water, after standing at room temperature for 2 hours, take 200 μL of the color reaction solution in a 96-well standard plate, measu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a tyrosine phenol lyase mutant, engineering bacteria and application of the tyrosine phenol lyase mutant and the engineering bacteria in catalytic synthesis of levodobar. The nucleotide sequence of a coding gene of the mutant is shown as SEQ ID No.5; compared with a wild type, the tyrosine phenol lyase mutant provided by the invention has more excellent catalytic performance. The accumulation concentration of the levodopa synthesized by the TPL mutant is up to 146g / L or above and is increased by 25-45% compared with that of a wild type, and the optical purity is greater than 99.5%; the conversion rate of the substrate catechol reaches 99.8% or above, and is increased by 15%-20% compared with that of a wild type.

Description

(1) Technical field [0001] The invention relates to a tyrosine phenol lyase mutant, an engineering bacterium and its application. (2) Background technology [0002] With the intensification of global aging, the increasing number of senile diseases is an unavoidable reality. Parkinson's disease is an senile disease that has gradually attracted public attention in recent years. It is a common chronic disease of the central nervous system. [0003] Dopamine is the main substance for the treatment of Parkinson's syndrome, but because it cannot reach the central nervous system through the blood-brain barrier, levodopa (β-3,4-dihydroxyphenyl-α-alanine, 3, 4-dihydroxyphenyl-L-alanine, L-DOPA) can pass through the blood-brain barrier, reach the central nervous system, and under the action of decarboxylase, convert it into dopamine, and then play the role of treating Parkinson's syndrome, so levodopa Drug of choice for the treatment of Parkinson's disease. Due to the increasing num...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/60C12N9/88C12N1/21C12P13/22C12R1/19
CPCC12N9/88C12Y401/99002C12P13/225C12N1/20
Inventor 郑仁朝王江平汤晓玲索慧郑裕国
Owner ZHEJIANG UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com