Preparation method for living-vector vaccine against rabies, product thereof and application thereof

A live carrier vaccine and rabies technology, which is applied in botany equipment and methods, biochemical equipment and methods, vaccines, etc., can solve the problems that there are no rabies live carrier vaccines on the market, and achieve short production cycle and good immune effect Effect

Inactive Publication Date: 2017-06-16
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Live-vector vaccines have the advantages of safety, high efficiency, and low production costs, but there is no rabies live-vector vaccine on the market

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method for living-vector vaccine against rabies, product thereof and application thereof
  • Preparation method for living-vector vaccine against rabies, product thereof and application thereof
  • Preparation method for living-vector vaccine against rabies, product thereof and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] The preparation of embodiment 1 rabies live vector vaccine

[0068] The method of this example can be used to prepare a replication-defective adenovirus rabies live vector vaccine for direct vaccination of animals. Including the following process, refer to Figure 4 :

[0069] 1. Preparation of target gene

[0070] Design primers, amplify rabies virus (Rabies Virus, RV) antigenic protein G gene and bacterial flagellin FIjB gene or FIiC gene by the method for PCR; Designed antigenic protein gene G and bacterial flagellin FIjB gene or FIiC gene amplification The primers are:

[0071] GF: 5'GCAGATCTGCCACCATGGTTCCTCAAAGCTCTTTTG3' (contains Bgl Ⅱ restriction site)

[0072] GR: 5'GCGTCGACTCACAGTCTGATCTCACC 3' (contains Sal Ⅰ restriction site)

[0073] FIjBF: 5'ATTGTCGACGCCACCATGGCACAAGTAATCAACACT 3' (contains Sal Ⅰ site)

[0074] FIjBR: 5'GCTCTAGATTAACGTAACAGAGACAGC 3' (contains Xba Ⅰ restriction site)

[0075] FIiCF: 5'ATTGTCGACGCCACCATGGCACAAGTCATTAATACA 3' (contains...

Embodiment 2

[0114] The immune efficacy experimental animal test data of embodiment 2 rabies live carrier vaccines

[0115] Three recombinant adenovirus live vectors constructed in Example 1, Ad-RV-G, Ad-RV-G-FljB, and Ad-RV-G-FliC, were used to immunize 6-8-week-old Balb / c on days 0 and 14, respectively. Blood was collected from the mice at 7, 14, 21, 28, 35, and 42 days after immunization, and the neutralizing antibody was measured by RFFIT method. The results are as follows: Figure 5 shown. The results showed that the neutralizing antibodies of the three recombinant adenoviruses all began to increase after the second immunization, and the level of neutralizing antibodies stimulated by the recombinant adenovirus Ad-RV-G-FljB was the highest, while the recombinant adenovirus Ad-RV-G The level of neutralizing antibody produced by -FliC was lower, but higher than that of Ad-RV-G. The results showed that the recombinant adenovirus co-expressed with flagellin FljB or FliC and rabies virus ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method for a living-vector vaccine against rabies, a product thereof and application thereof. The method comprises the following steps: 1, designing primers and amplifying a rabies virus antigen protein gene G and a bacterial flagellin gene FIjB or FIiC; 2, inserting the antigen protein gene G and the gene FIjB or FIiC between a specific promoter and a specific terminator of a replication-competent defective adenovirus shuttle vector so as to construct an adenovirus shuttle vector containing a gene G-FIjB or a gene G-FIiC; 3, subjecting the obtained recombinant replication-competent defective adenovirus shuttle vector and an adenovirus skeleton vector to homologous recombination so as to obtain recombinant adenovirus plasmids; and 4, producing recombinant adenoviruses with a uniform genomic structure from the recombinant adenovirus plasmids. Moreover, the invention also provides the living-vector vaccine against rabies prepared by using the method. Compared with the prior art, the living-vector vaccine against rabies prepared in the invention is safer and more effective, is short in a preparation period and has good application prospects in the field of prevention or treatment of rabies.

Description

technical field [0001] The present invention relates to a method for producing rabies live vector vaccine by utilizing viral vector and its product and application, especially a method for preparing rabies live vector vaccine by using adenoviral vector to express rabies virus G protein and bacterial flagellin, and its product and application. Background technique [0002] Rabies (rabies) is a zoonotic acute contagious infectious disease caused by rabies virus (rabies virus, RV) infection. Once the onset occurs, 100% of them will die. About 55,000 people die from the disease every year in the world, and about 3,000 people die every year in my country in the past five years, second only to India, mainly caused by dog ​​bites. Therefore, the main measure to prevent rabies is to immunize dogs, cats and wild animals with rabies vaccine. At present, the rabies vaccines for veterinary use in my country mainly include inactivated vaccines and attenuated vaccines. Although traditio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K39/205A61K39/39A61K48/00A61P31/14C12N15/47C12N15/861C12N7/01
CPCA61K39/12A61K39/39A61K2039/5256A61K2039/53A61K2039/545A61K2039/55516C07K14/005C12N7/00C12N15/86C12N2710/10021C12N2710/10043C12N2760/20122C12N2760/20134
Inventor殷相平肖星星张韵卫巧林李志勇柳纪省
OwnerLANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI