Applications of Xanthomonas pathopoiesis-associated gene

A Xanthomonas and gene technology, applied in the application field of genes in plant disease prevention and control, can solve the problems of crop yield reduction, harvest failure, economic loss, etc.

Active Publication Date: 2017-07-04
GUANGXI UNIV
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The damage of pathogens to host crops leads to crop yield reduction or even failure, causing serious economic losses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of Xanthomonas pathopoiesis-associated gene
  • Applications of Xanthomonas pathopoiesis-associated gene
  • Applications of Xanthomonas pathopoiesis-associated gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Determination of the transcription initiation site of the gene of Brassicaceae black rot fungus XC_2847 (hpaM, hereinafter referred to as XC_2847 gene)

[0064] Since the XC_2847 gene was annotated as encoding a "hypothetical protein" in the whole genome sequencing of the Xcc 8004 strain, whether this gene is a gene with a definite function is the first question to be determined. Here, first use 5'-RACE (i.e. 5' end rapid amplification method, an experimental method in molecular biology) to determine the transcription start site of XC_2847 gene, the specific method can refer to the description of literature Li Ruifang et al. (Li Ruifang et al. et al., 2014, please refer to the references listed below for details).

[0065] For this, 4 nested primers 2847RTP1-4 need to be designed:

[0066] 2847RTP1: AGATAGATGCCCTGGCTGCC;

[0067] 2847 RTP2 CGGTGCGATTGAACGACACG;

[0068] 2847RTP3: CGGTGCTGGCCACGATCTGCAT;

[0069] 2847RTP4: ATCGGCCATGCGCAGCACGG).

[0070] Culture Xcc...

Embodiment 2

[0077] Construction of XC_2847 gene mutant of Brassicaceae black rot fungus

[0078] To construct a deletion mutant of XC_2847, refer to the specific method The method described by et al. (Gene 1994, 145:69-73).

[0079] According to the DNA sequence of the upstream and downstream of the XC_2847 gene (the genome sequence number of the Xcc 8004 strain is: NC_007086), design primers:

[0080] 2847UF: ACAGTT GAATTC GATGGCGTCAACCAGCTCTC;

[0081] 2847UR: ACAGTT TCTAGA TCTAGTGTGTCGCACCAGGC)

[0082] 2847DF: ACAGTT TCTAGA GATGTGGCCGGCGTGGATATC;

[0083] 2847DR: ACAGTT AAGCTT ATTCCTGGACGTGGCGATGC;

[0084] Using the total DNA of Brassicaceae black rot fungus 8004 strain as a template, the PCR method (pre-denaturation at 95°C for 4 minutes; denaturation at 95°C for 1 minute, renaturation at 55°C for 30 seconds, extension at 74°C for 1 minute, 30 cycles; extension at 74°C for 5 minutes) The DNA homologous fragments of 747bp upstream and 726bp downstream of the XC_2847...

Embodiment 3

[0087] Cloning and sequence determination of XC_2847 gene and functional complementation of XC_2847 gene mutant

[0088] According to the DNA sequence of XC_2847 gene (NC_007086), design primers

[0089] 2847F: ACAGTT GGATCC GCCTACAGCTTCTGAGCCTG;

[0090] 2847R: ACAGTT AAGCTT GTGGCTGCGTAGCGGTTTTG;

[0091] Using the total DNA of the Xcc 8004 strain as a template, PCR method (pre-denaturation at 95°C for 4 min; denaturation at 95°C for 1 min, annealing at 55°C for 30 s, extension at 74°C for 2 min, and 30 cycles; extension at 74°C for 5 min) was used to amplify the entire DNA containing the XC_2847 gene. A long 1432bp DNA sequence. For the convenience of cloning, the restriction site sequences of BamHI and HindIII (that is, the underlined part of the above DNA sequence) were added to the 5' ends of the primers.

[0092] The obtained DNA fragment was cloned into the vector pGEM3Zf(+), and the DNA nucleotide sequence was determined on an ABI377 DNA automatic sequencer by...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses applications of a Xanthomonas pathopoiesis-associated gene hpaM in prevention and control of plant Xanthomonas diseases, wherein the number of the gene is XC_2847, the gene encodes a cell membrane protein, and the plant Xanthomonas diseases comprises one or a plurality of diseases selected from cruciferae black rot caused by cruciferae black rot bacteria, rice bacterial blight caused by rice bacterial blight bacterial, and rice bacterial leaf streak caused by rice bacterial leaf streak bacteria.

Description

technical field [0001] The invention relates to the prevention and control technology of plant diseases, in particular to the application of a gene related to Xanthomonas pathogenicity in the prevention and control of plant diseases. Background technique [0002] Plant diseases have always been one of the main problems plaguing agricultural production. Plant diseases are mainly caused by viruses, bacteria, fungi and nematodes. The damage of pathogens to host crops leads to crop yield reduction or even failure, resulting in serious economic losses. According to statistics, crop yield reduction due to diseases is as high as 20% in the world every year. Therefore, research and development of environmentally friendly plant disease control methods is a concern of people. An in-depth understanding of the pathogenic mechanism of pathogenic bacteria can provide a working basis and ideas for people to design and develop new methods of plant disease control, and the identification ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C07K14/195C12R1/64
CPCC07K14/195
Inventor陆光涛胡杰李瑞芳刘兴艳李磊王一诺唐纪良
OwnerGUANGXI UNIV