Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of pathogenic gene related to xanthomonas campestris pathovar campestris

A technology of Brassicaceae and black rot fungus, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of little knowledge

Inactive Publication Date: 2013-04-24
GUANGXI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, little is known about which protein factors or environmental signals regulate the expression of HrpG

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of pathogenic gene related to xanthomonas campestris pathovar campestris
  • Application of pathogenic gene related to xanthomonas campestris pathovar campestris
  • Application of pathogenic gene related to xanthomonas campestris pathovar campestris

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Construction of XC_3670 gene mutant of Brassicaceae black rot fungus

[0059] Adopt the strategy of gene replacement, replace the XC_3760 of 1239bp with a section of 927bp comprising kanamycin resistance gene (Kan) figure 1 ), construct a deletion mutant of XC_3760, the specific method is described by Lu Guangtao et al. (Acta Bioengineering 2003, 19(6): 661-667).

[0060] According to the DNA sequence of the upstream and downstream of the XC_3760 gene (genome sequence number NC_007086, Qian et al., 2005), design primers UF / R (UF: ACAGTT GAATTC GGGCAACGTGCGCGAGTT; UR: ACAGTT GGTACC AGCAGCACCACCACGGCC) and DF / R (DF: ACAGTT TCTAGA CAACGGCATGAACGAGGC; DR: ACAGTT CTGCAG CTCATACCGATCACTGCC), using the total DNA of Brassicaceae black rot fungus 8004 strain as template, using PCR method (pre-denaturation at 95°C for 4 min; denaturation at 95°C for 1 min, renaturation at 55°C for 30 s, extension at 74°C for 1 min, 30 cycles; extension at 74°C 5min) to amplify the DNA hom...

Embodiment 2

[0063] Cloning and Sequencing of XC_3670 Gene and Functional Complementation of XC_3670 Gene Mutant

[0064] According to the DNA sequence of XC_3670 gene (NC_007086, Qian et al., 2005), design primer 3670F / R (3670F: ACAGTT GGATCC TGCGTAATGTGCTGCAAC; 3670R:ACAGTT AAGCTTGACTCCAAACTGAGGCGC), using the total DNA of Brassicaceae black rot fungus 8004 strain as a template, PCR (pre-denaturation at 95°C for 4 minutes; denaturation at 95°C for 1 minute, renaturation at 55°C for 30 seconds, extension at 74°C for 2 minutes, 30 cycles; extension at 74°C for 5 minutes) Amplify the full-length sequence of the gene. For the convenience of cloning, the restriction site sequences of BamHI and HindIII (that is, the underlined part of the above DNA sequence) were added to the 5' ends of the primers. The obtained DNA fragment was cloned into the vector pGEM3Zf(+), and the DNA nucleotide sequence was determined on an ABI 377 DNA automatic sequencer by the Sanger end stop method (see sequenc...

Embodiment 3

[0072] Pathogenicity test of XC_3670 gene mutant of Brassicaceae black rot fungus and detection of its ability to induce allergic reaction

[0073] The host plant used in the experiment was radish seedlings (species name Raphanus sativus L.var.radiculusPers.), and the inoculation method used was the leaf-cutting method (Dow et al., 2003). Brassicaceae black rot fungus strains in NYG (per liter solution contains 5g of peptone, 3g of yeast extract and 20g of glycerol, abbreviated as NYG according to the three components, pH 7.0; Daniels et al., 1984) liquid medium in After incubating at 28°C for 15-18 hours, dilute to OD600≈0.01, use sterilized scissors to soak in the bacterial solution for 5 seconds, and cut healthy leaves to the central axis in the direction of the vertical veins 1-2cm away from the leaf tip. Stay for 5 seconds, and observe the results after culturing the inoculated plants at 25-30°C for 10 days. The positive control is the wild-type strain 8004 of Brassicacea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides an application of a pathogenic gene (XC_3670) related to xanthomonas campestris pathovar campestris in preventing and treating plant diseases, wherein a gene coding double-component regulating and controlling system can sense the protein histidine-kinase and influence the expression of hrp (hypothalamic regulatory peptides) genes. As a disease-resisting breeding target or medicinal target, the gene can be applied to preventing and treating the crucifer black rot disease.

Description

technical field [0001] The invention relates to the application of genes in the prevention and control of plant diseases, in particular to the application of a gene related to the pathogenicity of cruciferous black rot fungus in the prevention and control of plant diseases. Background technique [0002] Plant diseases have always been one of the main problems plaguing agricultural production. Plant diseases are mainly caused by viruses, bacteria, fungi and nematodes. The damage of pathogens to host crops leads to crop yield reduction or even failure, resulting in serious economic losses. According to statistics, crop yield reduction due to diseases is as high as 20% in the world every year. Therefore, research and development of environmentally friendly plant disease control methods is a concern of people. In-depth research on the pathogenic molecular mechanism of plant pathogens can provide a working basis for the design and development of new methods for plant disease c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29A01N57/16A01N43/50A01P3/00
Inventor 唐纪良陆光涛李瑞芳唐永勤何勇强
Owner GUANGXI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com