Application of pathogenic gene related to xanthomonas campestris pathovar campestris
A technology of Brassicaceae and black rot fungus, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of little knowledge
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Construction of XC_3670 gene mutant of Brassicaceae black rot fungus
[0059] Adopt the strategy of gene replacement, replace the XC_3760 of 1239bp with a section of 927bp comprising kanamycin resistance gene (Kan) figure 1 ), construct a deletion mutant of XC_3760, the specific method is described by Lu Guangtao et al. (Acta Bioengineering 2003, 19(6): 661-667).
[0060] According to the DNA sequence of the upstream and downstream of the XC_3760 gene (genome sequence number NC_007086, Qian et al., 2005), design primers UF / R (UF: ACAGTT GAATTC GGGCAACGTGCGCGAGTT; UR: ACAGTT GGTACC AGCAGCACCACCACGGCC) and DF / R (DF: ACAGTT TCTAGA CAACGGCATGAACGAGGC; DR: ACAGTT CTGCAG CTCATACCGATCACTGCC), using the total DNA of Brassicaceae black rot fungus 8004 strain as template, using PCR method (pre-denaturation at 95°C for 4 min; denaturation at 95°C for 1 min, renaturation at 55°C for 30 s, extension at 74°C for 1 min, 30 cycles; extension at 74°C 5min) to amplify the DNA hom...
Embodiment 2
[0063] Cloning and Sequencing of XC_3670 Gene and Functional Complementation of XC_3670 Gene Mutant
[0064] According to the DNA sequence of XC_3670 gene (NC_007086, Qian et al., 2005), design primer 3670F / R (3670F: ACAGTT GGATCC TGCGTAATGTGCTGCAAC; 3670R:ACAGTT AAGCTTGACTCCAAACTGAGGCGC), using the total DNA of Brassicaceae black rot fungus 8004 strain as a template, PCR (pre-denaturation at 95°C for 4 minutes; denaturation at 95°C for 1 minute, renaturation at 55°C for 30 seconds, extension at 74°C for 2 minutes, 30 cycles; extension at 74°C for 5 minutes) Amplify the full-length sequence of the gene. For the convenience of cloning, the restriction site sequences of BamHI and HindIII (that is, the underlined part of the above DNA sequence) were added to the 5' ends of the primers. The obtained DNA fragment was cloned into the vector pGEM3Zf(+), and the DNA nucleotide sequence was determined on an ABI 377 DNA automatic sequencer by the Sanger end stop method (see sequenc...
Embodiment 3
[0072] Pathogenicity test of XC_3670 gene mutant of Brassicaceae black rot fungus and detection of its ability to induce allergic reaction
[0073] The host plant used in the experiment was radish seedlings (species name Raphanus sativus L.var.radiculusPers.), and the inoculation method used was the leaf-cutting method (Dow et al., 2003). Brassicaceae black rot fungus strains in NYG (per liter solution contains 5g of peptone, 3g of yeast extract and 20g of glycerol, abbreviated as NYG according to the three components, pH 7.0; Daniels et al., 1984) liquid medium in After incubating at 28°C for 15-18 hours, dilute to OD600≈0.01, use sterilized scissors to soak in the bacterial solution for 5 seconds, and cut healthy leaves to the central axis in the direction of the vertical veins 1-2cm away from the leaf tip. Stay for 5 seconds, and observe the results after culturing the inoculated plants at 25-30°C for 10 days. The positive control is the wild-type strain 8004 of Brassicacea...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap