Replication-defective human 14-type adenovirus vector, and preparation method and applications thereof

A replication-deficient, adenovirus technology, applied in the direction of viruses/bacteriophages, botany equipment and methods, biochemical equipment and methods, etc., can solve problems such as inability to perform immune or therapeutic functions, and limit the use of adenovirus vectors

Inactive Publication Date: 2017-07-04
GUANGZHOU N BIOMED LTD
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The use of adenoviral vectors is mainly focused on Ad2 and Ad5. Since humans are naturally infected with adenoviruses, most humans have anti-Ad2 ​​and Ad5 antibodies, which limits the use of traditional adenoviral vectors.
Ad2 and Ad5 neutralizing antibodies are very high in people in developing countries and regions such as Africa, South America, and my country, and the positive rate is even as high as 90%. Function

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Replication-defective human 14-type adenovirus vector, and preparation method and applications thereof
  • Replication-defective human 14-type adenovirus vector, and preparation method and applications thereof
  • Replication-defective human 14-type adenovirus vector, and preparation method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Example 1: Circularization of the Ad14 genome.

[0077] 1. Construction of the shuttle plasmid pT-Ad14(L+R) for circularizing the Ad14 genome.

[0078] Using the Ad14 genome as a template, the left arm (L-Ad14) and the right arm (R-Ad14) of the Ad14 genome were obtained by PCR.

[0079] L-Ad14 primer:

[0080] L-Ad14-F,CCTGCCGTTCGACGATGCGATCGCATCATCAATAATAT ACCTTATAGATGG

[0081] L-Ad14-R,GATCCACATACGAATTCCGGTAATCGAAACCTCCACG

[0082] PCR conditions: 95°C, 3min; 95°C, 30s; 57°C, 30s; 72°C, 30s; cycles 30; 72°C, 5min;

[0083] R-Ad14 primer:

[0084] R-Ad14-F,GAATTCGTATGTGGATCCTGGGAACCACCAGTAATGTCA

[0085] R-Ad14-R,CGCGGATCTTCCAGAGATGCGATCGCATCATCAATAA TATACCTTATAGATGG

[0086] PCR conditions: 95°C, 3min; 95°C, 30s; 57°C, 30s; 72°C, 1min; cycles 30; 72°C, 5min;

[0087] 2. Construction of pAd14.

[0088] pT-Ad14(L+R) was digested and linearized with EcoRI+BamHI, and then co-transformed with the Ad14 genome into BJ5183 competent cells for recombination. The ampic...

Embodiment 2

[0089] Example 2: Knockout of E3 gene and construction of pAd14ΔE3-Kana plasmid.

[0090] 1. Construction of the E3 gene knockout shuttle plasmid pVax-ΔE3(L+R).

[0091] Using the genome of Ad14 as a template, the left arm (L-ΔE3) and the right arm (R-ΔE3) of the E3 gene were obtained by PCR.

[0092] L-ΔE3 primer:

[0093] L-ΔE3-F, GATATCTAGAGTGAATTCGTCCAAATGACTAATGCAGG TGC

[0094] L-ΔE3-R,CCAGTAGAAGCGCCGGATTTAAATAGGAAAAGTTTCG TTCTTCTGGTTG

[0095] PCR conditions: 95°C, 3min; 95°C, 30s; 61°C, 30s; 72°C, 50s; cycles 30; 72°C, 5min;

[0096] R-ΔE3 primer:

[0097] R-ΔE3-F, ATTATTGACTAGAGTAATTTAAATGGACTAAGAGACCT GCTACCCATG

[0098] R-ΔE3-R,GAATTCACTCTAGATATCCCACTTTTAGCTGTAGAGAC CCG

[0099] PCR conditions: 95°C, 3min; 95°C, 30s; 60°C, 30s; 72°C, 30s; cycles 30; 72°C, 5min;

[0100] L-ΔE3, R-ΔE3 and Bstz17I+SgrAI double digested the plasmid backbone obtained from the pVax vector using Exnase enzyme for three-segment ligation to obtain pVax-ΔE3(L+R).

[0101] 2. Construct...

Embodiment 3

[0103] Example 3: Construction of the pAd14ΔE3 plasmid pAd14ΔE3 in which the Kana resistance gene was knocked out in the pAd14ΔE3-Kana plasmid.

[0104] 1. Construction of the shuttle plasmid pVax-ΔK(E3) for knocking out the Kana resistance gene in the E3 region.

[0105] Using the Ad14 genome as a template, the left arm L-ΔK (E3) and the right arm R-ΔK (E3) of the E3 gene were obtained by PCR.

[0106] L-ΔK(E3) primer:

[0107] L-ΔK(E3)-F, TGATTATTGACTAGAGTATACGTCCAAATGACTAATG CAGGTGC

[0108] L-ΔK(E3)-R:GATATCATTTAAATACTAGTAGGAAAAGTTTCGTTCTTCTGGTTG

[0109] PCR conditions: 95°C, 3min; 95°C, 30s; 60°C, 30s; 72°C, 50s; cycles 30; 72°C, 5min;

[0110] R-ΔK(E3) primer:

[0111] R-ΔK(E3)-F, ACTAGTATTTAAATGATATCGGACTAAGAGACCTGC TACCCATG

[0112] R-ΔK(E3)-R,ACCGCCCAGTAGAAGCGCCGGTGCCACTTTTAGCT GTAGAGACCCG

[0113] PCR conditions: 95°C, 3min; 95°C, 30s; 60°C, 30s; 72°C, 30s; cycles 30; 72°C, 5min;

[0114] L-ΔK(E3), R-ΔK(E3) and the plasmid backbone obtained by double digestio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of biology and particularly relates to a replication-defective human 14-type adenovirus vector, and a preparation method and applications thereof. The preparation method includes the steps of plasmidizing Ad 14 genome to knock-out E3 and E1 genes therefrom, and further changing open reading frames 2, 3, 4, 6, and 6 / 7 of an E4 gene into corresponding reading frames of Ad5 genome. The replication-defective human 14-type adenovirus vector can be potentially applied in research on anti-human 14-type adenovirus infection vaccines, screening of neutralizing antibodies and medicines for anti-human 14-type adenovirus infection, research on other pathogenic vaccines as a gene vector, a report tracing system for biological research, etc.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a replication-deficient human type 14 adenovirus vector and its preparation method and application. Background technique [0002] Adenovirus (Adenovirus, Ad) is a double-stranded DNA virus with a genome length of 34-38 kb. Currently reported adenoviruses have 69 genotypes, which can be divided into seven subgroups, A-G. Adenovirus can not only cause asymptomatic infection, but also induce respiratory disease, eye disease and gastroenteritis, etc. Adenovirus types 3 and 7 of subgroup B and type 4 of subgroup E often induce severe respiratory disease. Adenovirus type 14 was first discovered from the Dutch army in 1955. For half a century, it did not cause severe respiratory diseases and widespread epidemics; Later, adenovirus type 14 caused frequent infections and deaths in the United States. Subsequently, infection and death caused by adenovirus type 14 occurred in the Irish regio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/861C12N15/66A61K39/235A61K39/42A61K48/00A61P31/20
CPCA61K39/12A61K39/42A61K48/0025C12N15/86C12N2710/10331C12N2710/10334C12N2710/10343A61P31/20C12N2710/10322C12N2710/10351C12N2710/10361C12N2710/10362A61K39/235C12N15/66
Inventor 陈凌冯立强李楚芳孙西魁
Owner GUANGZHOU N BIOMED LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap