Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker method of cucumber spire etiolation gene

A technology of molecular markers and young leaves, which is applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of gene positioning and function research, such as rare, stay, etc., to achieve the industrialization of gene molecular breeding, Solve the effect of low reliability and convenient identification

Active Publication Date: 2017-07-18
NANJING AGRICULTURAL UNIVERSITY
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, although there are many reports of leaf color yellowing mutants in cucumber, most of the current research is still on the mechanism of leaf color yellowing, and there are not many reports on gene location and function research.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker method of cucumber spire etiolation gene
  • Molecular marker method of cucumber spire etiolation gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] The yellowing molecular markers of young cucumber leaves were obtained by the following methods:

[0033] (1)F 2 group building

[0034] The yellowing mutant vyl of young cucumber leaves was screened from the mutant library of 'Changchun Mizhi' induced by EMS. Hazerd is a European greenhouse type cucumber with dark green leaves. Use these two parents to configure F 1 , F 1 Generation of selfing to produce F 2 generation. Statistics 998 F 2 The phenotype of the population was verified by chi-square analysis, and it was concluded that the yellowing of young cucumber leaves was a recessive trait controlled by a single gene.

[0035] (2) Extraction of cucumber genomic DNA

[0036] Extract the parent according to the conventional method - CTAB method, F 1 and all F 2 Total leaf DNA of isolated populations.

[0037] (3) Young leaf yellowing and green leaf gene pool establishment

[0038] Using population segregation method (BSA) from F 2 10 young-leaf yellowed an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker method of cucumber spire etiolation gene linking, belonging to the biotechnical field. A molecular marker SSR63 closely linked to the cucumber spire etiolation gene is disclosed for the first time, the forward and reverse primers of the marker are respectively: 5'GCTTCATCCTGTGGCGT3' and 5'CCAGTCATGGGTTTGTTGGA3'. In F2 constructed from spire cucumbers and green-leaf cucumbers, 226bp products can be amplified from the primers SSR63F / SSR63R inspire etiolation strain, 204bp product or product containing both 204bp and 226bp strips can be amplified in green-leaf strain, and all the products can be closely linked with vyl. The molecular marker closely linked with cucumber spire etiolation gene vyl can be used for cucumber spire etiolation gene mapping or molecular marker-assisted breeding.

Description

[0001] 1. Technical field [0002] The invention belongs to the field of biotechnology, and relates to a molecular marker and application of the yellowing gene of young cucumber leaves. [0003] 2. Technical background [0004] Cucumber (Cucumis sativus L., 2n=2x=14) is one of the most important vegetable crops in the world and is widely cultivated worldwide. [0005] Leaf color yellow mutants are ideal materials for studying plant photosynthesis mechanism, chlorophyll biosynthesis pathway, chloroplast development and genetic control mechanism. At the same time, the use of such mutants can be extended to the analysis of functional genomics, and can be used as basic materials for gene functional omics research and gene interactions. Leaf color mutation also has important application value in breeding. Leaf color mutants are easy to identify and are usually expressed at the seedling stage. The leaf color mutants are used as marker traits for improved seed breeding and hybrid br...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 娄群峰王晶李子昂魏庆镇陈劲枫
Owner NANJING AGRICULTURAL UNIVERSITY