Cas9 nuclease and application thereof

A technology of nuclease and nuclease activity, which is applied in the field of Cas9 nuclease R780A to achieve the effect of precise editing

Pending Publication Date: 2017-07-28
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 31 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the editing of DNA fragments can be realized through the CRISPR / Cas9 system, but for the in-depth study of the precise function of specific DNA segments, the Cas9 nuclease that can effectively realize the precise genetic editing of DNA fragments has yet to be discovered

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cas9 nuclease and application thereof
  • Cas9 nuclease and application thereof
  • Cas9 nuclease and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Example 1 Studying the Ligation of DNA Fragment Editing Adapters and Discovering a New Mechanism of Cas9 Cutting

[0077] For the HS51 site, construct the sgRNAs plasmid targeting the HS51 site:

[0078] (1) Purchase primers

[0079] Purchase forward and reverse deoxy oligonucleotides with 5' hanging ends "ACCG" and "AAAC" that can be complementary paired for the HS51 site and the sgRNAs targeting sequence respectively from Shanghai Sunny Biotechnology Co., Ltd.;

[0080] Targeting sequences of sgRNAs targeting the above HS51 site:

[0081] HS51 RE1 sgRNA1: GCCACACATCCAAGGCTGAC (SEQ ID NO.1)

[0082] HS51 RE1 sgRNA2: GAGATTTGGGGCGTCAGGAAG (SEQ ID NO.2)

[0083] (2) Obtain complementary paired double-stranded DNA with hanging ends

[0084] 1) use ddH 2 O Dissolve deoxyoligonucleotides to 100 μM and dilute to 20 μM;

[0085] 2) Add positive and negative deoxy oligonucleotides to the following reaction system:

[0086]

[0087] Reaction conditions: 95°C water bat...

Embodiment 2

[0155] Example 2 Mutation of SpCas9 to obtain a specific Cas9 with a changed cutting method to achieve precise DNA fragment editing

[0156] 1. Construction of Cas9 mutants

[0157] 1) Use NEB Mutagenesis Kit (Q5Site-Directed Mutagenesis Kit, #E0554S) to construct Cas9 mutants, first perform PCR amplification, and the reaction is as follows:

[0158]

[0159]

[0160] 2) KLD (Kinase, Ligase&DpnI) treatment, the reaction is as follows:

[0161]

[0162] Reaction conditions: 10 minutes at room temperature

[0163] 3) All the reaction products in 2) were used for the transformation of competent bacteria Stbl3 (50 μl), and cultured on LB plates containing ampicillin antibiotic (Amp, 100 mg / L) overnight at 37° C. Single clones were picked, plasmids were extracted and sent for sequencing.

[0164] The amino acid sequence of SpCas9 (Cas9WT) is shown in SEQ ID NO.7, specifically:

[0165]

[0166]

[0167] The coding nucleotide sequence of SpCas9 (Cas9WT) is shown i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology and in particular relates to a Cas9 nuclease and application thereof. The Cas9 nuclease (Cas9-R780A) has Cas9 nuclease activity and is suitable for being used in a CRISPR / Cas9 system; theCas9 nuclease is prepared by mutating arginine at the 780 site of the wild-type Cas9 nuclease to alanine. DNA double strands can be cut by using the Cas9 nuclease (Cas9-R780A) so as to generate a protruded cleavage terminal, and then a base complementary to the protruded cleavage terminal can be added in a continuity filling-in manner, so that the precise editing of a specific position of a genomic DNA fragment can be realized.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a Cas9 nuclease R780A and its application. Background technique [0002] Since the completion of the Human Genome Project and the Encyclopedia of DNA Elements, scientists have analyzed and identified a large number of genes and DNA regulatory elements in the genome [1,2]. DNA regulatory elements that play an important role in the regulation of gene expression include promoters, enhancers, silencers, and insulators. However, the functions of most regulatory elements have not been experimentally verified and elucidated [2-8]. Exploring the function of genes and DNA regulatory elements can be studied through genetic DNA segment editing. [0003] Early gene editing and gene function modification were achieved through gene transposition and transgenesis [9-14]. With the development of sequencing technology, reverse genetics has been applied to make specific mutations in the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/22C12N15/55C12N15/113C12N15/63
CPCC12N9/22C12N15/113C12N15/63C12N2310/10C12N2800/80
Inventor吴强李金环寿佳
OwnerSHANGHAI JIAO TONG UNIV