Method and device for determining pre-rearrangement V/J gene sequences

A technology for identifying devices and J genes, applied in the field of bioinformatics, can solve problems such as difficulty in accurate assembly and correction, and influence on germline inference, and achieve the effect of reducing difficulty, shortening time and cost

Active Publication Date: 2017-08-11
SHENZHEN HUADA GENE INST
View PDF7 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It is difficult to accurately correct the assembly of highly repetitive regions of the germline region of the species, which affects the inference of the germline
Also, to date there is no software or tool for inferring germline sequences

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and device for determining pre-rearrangement V/J gene sequences
  • Method and device for determining pre-rearrangement V/J gene sequences
  • Method and device for determining pre-rearrangement V/J gene sequences

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] The general method includes the following steps:

[0071] For RNA samples, a set of universal primers optimized by the inventors can be used to amplify the variable region of TCR, BCR or Ig by 5'race:

[0072]The variable region is formed by the rearrangement of the V, D, and J gene segments of TCR or Ig. During the rearrangement process, there are nucleotide insertions and deletions at the junctions between the gene segments. This region reflects the surface of adaptive immune molecules. Diversity of receptors. The C region is a constant region. For RNA, primers can be designed in the C region to amplify the variable region, and then the variable region obtained by the rearrangement of the V region and J region of different subfamilies can be amplified by the 5'race method.

[0073] (2) Library preparation

[0074] Step 1 Synthesize the first strand of cDNA through the reverse transcription primer of the C region and Superscript II, and then digest the RNA in the cDN...

Embodiment 2

[0097] (1) Experimental process

[0098] (1) 5'RACE enrichment of the target fragment

[0099] The peripheral blood of three normal people was drawn, and the peripheral blood mononuclear cells (peripheral blood mononuclear cell PBMC) were separated to extract RNA, and three RNA samples were obtained, which were recorded as sample 1 (HRB), sample 2 (HXY) and sample 3 (XHS). RNA is reverse transcribed into cDNA by TCR constant region C-specific primers. The following systems take the number of reactions of a sample as an example.

[0100] 1.1 cDNA 1st synthesis

[0101] 1) Prepare according to the following system (1 sample)

[0102]

[0103] Primer for TCRC region: TTGATGGCTCAAAACACAGCGA (SEQ ID NO: 1)

[0104] 2) 70°C for 10min, place on ice for 1min, add the following system, and incubate at 42°C for 1min.

[0105]

[0106] 3) Add 1 μL Superscript II, react at 42°C for 50 minutes, and react at 70°C for 15 minutes.

[0107] 4) Add 1 μL RNase mix and incubate at 37°...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for determining pre-rearrangement V and / or J gene sequences. The method comprises the following steps of: (1) obtaining sequencing data of a to-be-tested RNA sample, wherein the sequencing data comprises a plurality of reads from variable regions of TCR, BCT and / or Ig; (2) determining parts, from V / J gene fragments, on the reads according to arrangement relationship of V, J and C gene fragments in the variable regions on the basis of the sequencing data, so as to obtain a plurality of V / J region parts; (3) taking out at least one section of sequence from each V / J region part as a seed sequence, so as to obtain a seed sequence set comprising a plurality of seed sequences; (4) clustering the V / J region parts according to the difference of support number of the V / J region part of each seed sequence, so as to obtain a plurality of V / J region part clusters; (5) extending seed sequence supported by each V / J region part cluster by utilizing each V / J region part cluster, so as to obtain a plurality of candidate pre-rearrangement V / J gene sequences; and (6) filtering support conditions of the candidate pre-rearrangement V / J gene sequences by utilizing the reads, so as to obtain a pre-rearrangement V / J gee sequence.

Description

technical field [0001] The invention belongs to the field of biological information, and specifically, the invention relates to a method and a device for determining the V / J gene sequence before rearrangement. Background technique [0002] There is a cluster of V genes and a cluster of J genes on the germline cells (Germline), and some V / J genes have a cluster of D genes between them. The genes in the gene clusters are separated by introns and arranged in series on the same chromosome , and the homology between genes is very high [Animal Immunology [M]. China Agricultural University Press, 1996.]. Generally, there are dozens of genes in a cluster, and each gene may be different in different individuals. For example, there are 40 genes in the V gene cluster of human-encoded antibody heavy chain (IGH), and 25 genes in the D gene cluster. The J gene cluster has 6 genes, of which 40 V genes have a total of 425 alleles (alleles). [0003] For lymphocytes, during the process of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G06F19/18C12Q1/68
CPCC12Q1/6869G16B20/00
Inventor张伟齐彦伟王长希刘晓
OwnerSHENZHEN HUADA GENE INST