Method for controlling plasmid replication in escherichia coli

A technology of Escherichia coli and plasmids, which is applied in the field of bioengineering, can solve the problems that cannot be well applied, single regulation mode, difficult to dynamically regulate the regulation of different abilities of plasmid replication, and achieve novel design, wide regulation range, and regulation powerful effect

Inactive Publication Date: 2017-09-08
NANJING GENSCRIPT BIOTECH CO LTD
View PDF9 Cites 30 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] However, due to patent restrictions and general practical effects, neither of these two methods can be well applied.
In addition, since these two methods achieve the purpose of regulating plasmid replication by regulating the function of the small RNA that initiates replication of the ColEI replicon, the regulation mode is single, and these methods are difficult to be used for dynamic regulation of plasmid replication or different capabilities. regulation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for controlling plasmid replication in escherichia coli
  • Method for controlling plasmid replication in escherichia coli
  • Method for controlling plasmid replication in escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Using the Crispr / Cas9 system to regulate the replication of a high-copy plasmid carrying a ColE1 type replicon

[0028] The purpose of this example is to construct a set of Crispr / Cas9 system to regulate the replication of a high-copy plasmid carrying a ColEI type replicon. The steps are as follows:

[0029] 1. For the ColEI type replicon region, design 3 different gRNA target sequences, named G-01 (accagcggtggtttgtttgc), G-02 (tcgccactggcagcagccac), G-03 (ctttctcccttcgggaagcg) (see attached figure 2 ), wherein the sequence adjacent to the 3' end of the target sequence is NGG. Wherein G-01 is located on the positive strand of the DNA in the replication region, and G-02 and G-03 are located on the negative strand of the DNA in the replication region.

[0030] 2. Aiming at the high-copy plasmid of the ColEI type replicon, design a plasmid expressing the Crispr / Cas9 regulatory system, which has the following characteristics: a. 1 temperature-sensitive replicon ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for controlling plasmid replication in escherichia coli. A plasmid control method developed is based on a Crispr / Cas9 system; plasmid replication is effectively regulated and controlled by the aid of expressed dCas9 protein and transcribed gRNA targeting a target sequence of a plasmid replication area, and the method is a brand new method which is not reported in other documents and patents. The target sequence targeting the replication area can have multiple choices, and the purpose of controlling the plasmid replication of different degrees is assuredly realized by the aid of different dCas9 / gRNA pairs. The method can effectively reduce the yield of plasmids by 2-34 times, and compared with a previous method reported in the patents, the method has the advantages of wide range of control and higher control capacity; in conclusion, the method is novel in design and can realize control over the plasmid replication of different degrees effectively.

Description

technical field [0001] The invention relates to the field of bioengineering, in particular to a method for controlling plasmid replication in Escherichia coli. [0002] technical background [0003] Plasmids are small DNA molecules that can replicate independently of chromosomes in cells. Its length varies from thousands to millions of bases. Its copy number can also vary from a few to thousands. Naturally occurring plasmid molecules usually have no decisive effect on the survival of host cells, but they can carry some special genes, such as antibiotic resistance genes, pathogenic regulatory genes, etc., to increase the genetic and physiological diversity of host cells. In view of these characteristics, around the 1970s, plasmid DNA was developed as an effective genetic engineering carrier to carry foreign genes to specific hosts for gene cloning and foreign protein expression. [0004] Escherichia coli (Escherichia coli) is a Gram-negative short bacillus, which is one of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/55
CPCC12N9/22C12N15/70C12N2810/10
Inventor黄小罗方惠敏张丽华柳振宇
OwnerNANJING GENSCRIPT BIOTECH CO LTD