CRISPR/Cas9-based novel method for achieving multigene knockout in low-transfection-efficiency cell line

A technology of transfection efficiency and cell lines, applied in the field of molecular biology, can solve problems such as sgRNA and Cas9 off-target effects

Active Publication Date: 2017-09-12
SHAANXI NORMAL UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, when using lentivirus for gene knockout, sgRNA and Cas9 are randomly integrated into the genome and expressed persistently. After the targeting is completed, the overexpressed sgRNA and Cas9 are likely to cause off-target effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR/Cas9-based novel method for achieving multigene knockout in low-transfection-efficiency cell line
  • CRISPR/Cas9-based novel method for achieving multigene knockout in low-transfection-efficiency cell line
  • CRISPR/Cas9-based novel method for achieving multigene knockout in low-transfection-efficiency cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1: Design, synthesis and vector construction of sgRNA targeting Ecm1 and Pgrn gene exons

[0055] (1) Select the Exon corresponding to the region where the gene mainly functions, and the length is about 400-1200bp;

[0056] (2) Find all NGGs and their first 12 bases in the exon region and perform Blast at NCBI to screen out the sequence that exactly matches the target sequence and the only one (if there is no NGG that meets the requirements, look up the CCN in reverse), reducing the potential off-target sites;

[0057] In this example, sgRNAs for Ecm1 exon 6 and Ecm1 exon 7 and sgRNAs designed for Pgrn exon 5 and Pgrn exon 6 are designed, wherein: the sgRNA sequence for Ecm1 exon 6 is: ggatggcttc ccccctggg (Sequence Listing1); the sgRNA sequence for Ecm1 exon 7 is: agctactgac cccctacaa (Sequence Listing2), and the sgRNA sequence for Pgrn exon 5 is: cgtgctgtgt tatggtcga (Sequence Listing 3); the sgRNA sequence for Pgrn exon 6 is: cggtgccttc tgcgacc (sequence li...

Embodiment 2

[0058] Example 2: Construction and packaging of lentivirus targeting Ecm1 and Pgrn genes

[0059] (1) Cloning two loxP sites in the same direction into the pCDH-CMV-MCS-EF1α-Puro vector to obtain the pCDH-CMV-loxp-MCS-loxp-EF1α-Puro vector;

[0060] (2) Cloning the tandem Ecm1 and Pgrn sgRNA expression components and the Cas9 gene into the pCDH-CMV-loxp-MCS-loxp-EF1α-Puro lentiviral vector to obtain a lentivirus expressing multiple PGRN and ECM1 sgRNA expression components and the Cas9 gene simultaneously Vector pCDH-CMV-loxp-Cas9-Ecm1&Pgrn sgRNAs-loxp-EF1α-Puro (such as figure 1 shown);

[0061] (3) Clone the Cre gene into the pCDH-CMV-MCS-EF1α-Neo vector to obtain the lentiviral vector pCDH-CMV-Cre-EF1α-Neo expressing the Cre protein (such as figure 2 shown);

[0062] (4) The lentiviral vectors pCDH-CMV-loxp-Cas9-Ecm1&PgrnsgRNAs-loxp-EF1α-Puro, pCDH-CMV-Cre-EF1α-Neo were co-transfected with lentiviral packaging plasmids into HEK293T cells for lentiviral packaging, and th...

Embodiment 3

[0063] Example 3: Using lentivirus to specifically knock out Ecm1 and Pgrn genes

[0064] Taking the targeting of the Ecm1 and Pgrn genes of the breast cancer cell line MDA-MB-231 as an example, the process is as follows:

[0065] (1) MDA-MB-231 cells were cultured in 60mm dishes, infected with lentivirus Lenti-Cas9-sgRNAs, added Puromycin (1.0mg / mL) after infection for 3-4 days to obtain MDA integrating Ecm1 and Pgrn sgRNA with Cas9 -MB-231 cells; collect the MDA-MB-231 cell genome integrating Ecm1 and Pgrn sgRNA and Cas9, use primers hEcm1test for sequence aggtaccgaa cgccagctcc atttg (sequence listing 5), hEcm1test back sequence aagatctggccttccatgta caggtgtg (sequence listing 6), hPgrn test for sequence aggtacctgtgtgatgggggagtcacctt (sequence listing 7) and hPgrn test back sequence aagatctgctggctccagcc cctcactca (sequence listing 8) were amplified by PCR and denatured and annealed (such as image 3 , where line 2 is hEcm1, line 4 is hPgrn PCR amplification product, line 1 is...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel method for efficiently knocking out low-transfection-efficiency cells on the basis of lentivirus expression CRISPR / Cas9. The method is characterized in that the method relates to two lentiviruses which include a lentivirus for expressing sgRNA and Cas9 and a lentivirus for expressing Cre protein; the multigene sgRNA and Cas9 are simultaneously cloned to a position between two same-direction loxp of a lentivirus vector, simultaneous multigene knockout in the low-transfection-efficiency cells is achieved, the Cas9 and sgRNA integrated in a genome are effectively removed by using the lentivirus expressing Cre, and an off-target effect caused by Cas9 and sgRNA overexpressing is prevented. The method has the advantages that the method combines the features that the lentiviruses can effective infect cleavage and non-cleavage cells and an loxp-Cre system can perform efficient removing reaction, and the system is low in toxicity, high in gene knockout efficiency, high in accuracy, short in cycle and significant to the realizing of multigene knockout in a low-transfection-efficiency cell line.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to the technology and application of using CRISPR / Cas9 technology to realize simultaneous knockout of multiple genes in low transfection efficiency cell lines. It specifically relates to a new method based on CRISPR / Cas9 multiple gene knockout of low transfection efficiency cell lines. Background technique [0002] CRISPR / Cas9 is an immune defense system formed by the long-term evolution of bacteria and archaea. This system uses CRISPR-derived RNA (crRNA) to form a complex with trans-activating RNA through base pairing. Cas9 endonuclease is guided by this complex. Site-directed cleavage of sequences paired with crRNA. Therefore, by artificially designing sgRNA (short guide RNA) with a guiding function, Cas9 can be guided to cut host cell DNA at a specific point, and then repair it through the mechanism of non-homologous end joining (NHEJ) to realize gene editing. [0003] At present...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867
CPCC12N9/22C12N15/86C12N2740/15043C12N2800/107C12N2810/10
Inventor夏海滨李雅张伟锋朱久玲李燕
OwnerSHAANXI NORMAL UNIV