Probe, primer and gene chip for identifying cryptococcus laurentii

A cryptococcal yeast and gene chip technology, applied in the biological field, can solve the problems of increasing the detection cycle, determining the pathogenic bacteria, and shortening the detection cycle and the shelf life of dairy products, and achieves the effect of providing accuracy and reliable results.

Pending Publication Date: 2017-09-15
SHANXI WELL BIOLOGY DAIRY PROD CO LTD
View PDF10 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, dairy companies basically use the traditional plate culture method to detect microorganisms. The detection cycle of this method is generally about 3-4 days, but some pathogenic bacteria cannot be judged only by the colony shape, and other biochemical reaction tests are required. For further identification, this will undoubtedly increase the detection cycle
Therefore, there is a gap between a longer detection cycle (5-6 days to complete the detection of 10 microorganisms required by the national standard) and a shorter shelf life of dairy products (the shelf life of pasteurized dairy products without destroying nutrients is only 7 days) A contradiction has been formed, which has become an important bottleneck restricting the development of dairy enterprises and an important factor restricting the market terminal from obtaining the most nutritious dairy products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe, primer and gene chip for identifying cryptococcus laurentii

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Determination of target sequence

[0045] According to the reported gene sequence of Cryptococcus laurenii, the following sequences were selected as the target sequences for detection.

[0046] Cryptococcus rorentii ITS:

[0047]TCCGTAGGTGAACCTGCGGAAGGATCATTAAAGATTGACCGAAAGGTCTTATCTCTATATCCCTCACCTCTGTGAACTGTGGACCTCCGGGTCTGTCTTAACAAACATCAGTGTAATGAACGTATATATCATTAAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATGAAATCTCAATCCCCCCGGGTTTATGATCTGGGTCGGACTTGGACATGGGCGTCTGCCGGTCACACGGCTCGCCTCAAATGACTTAGTGGATCTCTCTGCATCCGTGACAGACGTAATAAGTTTCGTCTTGTCCCTTGCTAATGAGTCTGCTCATAACCTGCCATCGCGCACTTTTAGACTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGG

[0048] Cryptococcus rorentii rpb I:

[0049] GTCAAGAAGATCATCGAGTGTGTTTGTGTCAGCTGCGGAAAGCTCAAGTGTGATATGGTAAGTCTCAACAAGGGTCTCACTATGATCGTCACTAACCGTTCAGCGGGACCCTGAAGTGCGAAACATCCGACGTCAGATCAAGCCGCAACATCGTTTGAAGCG...

Embodiment 2

[0051] Example 2 Design and synthesis of primers and probes

[0052] After the target sequence is determined, according to the design principles of primers and probes, design primers and probes as follows:

[0053] Cryptococcus rorentii ITS:

[0054] Primer 1: 5'cy3-TCCGTAGGTGAACCTGCGGAAGG-3'.

[0055] Primer 2: 5'-CCGCTTATTGATATGCTTAAGTTC-3'.

[0056] ’ NH 3 — TTTTTTTTTTTGATGCGAGAGCCAAGAGATCCGTTGTTG — 3'.

[0057] Cryptococcus rorentii rpb I:

[0058] Primer 1: 5'cy3-GTCAAGAAGATCATCGAGTGTG-3'.

[0059] Primer 2: 5'-GTATTGGAGCAAATCGAAATG-3'.

[0060] ’ NH 3 — TTTTTTTTTTTTGCTTCAAACGATGTTGCGGCTTGATCTG — 3'.

[0061] After the homology comparison search, it is determined that the selected target sequence is a DNA sequence with high specificity, which can be used as the target sequence for gene chip detection.

Embodiment 3

[0062] Example 3 template extraction

[0063] Put 2ml of dairy product at -80°C for 15 minutes, take it out and place it in a grinder, grind it as a whole into a powder in a liquid nitrogen environment, and use the CTAB method to extract the nucleic acid in the powder.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a probe, a primer and a gene chip for identifying cryptococcus laurentii. A specific molecular marker of the cryptococcus laurentii ITS has a nucleotide sequence as shown in SEQ ID NO.1. The gene chip for detecting penicillium for the design specificity of the molecular marker is capable of carrying out specificity identification on the cryptococcus laurentii within a short period of time and improving the accuracy and the sensitivity of cryptococcus laurentii identification and has the characteristics of being fast, accurate and low in cost.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a special primer, a probe and a gene chip for identifying Cryptococcus laurenii. Background technique [0002] Dairy products are nutritious, easily digested and absorbed natural foods. With the improvement of people's living standards, they have become common foods in daily life. However, nutrient-rich dairy products are also hotbeds favored by various microorganisms, which leads to a very limited shelf life of dairy products. For example, the shelf life of pasteurized dairy products generally does not exceed 7 days (pasteurized fresh milk accounts for 70% of global liquid milk market share), the shelf life of fermented yogurt, which has been increasing in market share in recent years, is generally only 21 days. [0003] On the other hand, the national "Food Safety Law" and "Detailed Rules for the Examination of the License Conditions for the Production of Dairy Products of Enterpr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/645
CPCC12Q1/6895
Inventor杜莹李海涛潘佩平马金鑫蔡宇张国柱王慕华郭明伟宫俊峰赵玉明
OwnerSHANXI WELL BIOLOGY DAIRY PROD CO LTD