Primer and probe used for detecting gene methylation, and sampling method and kit thereof
A methylation and non-methylation technology, used in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve problems such as insufficient sensitivity, and achieve improved sensitivity, clear and objective judgment, and operation. simple effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0102] After bisulfite treatment, cytosine was converted to uracil, and 5-methylcytosine (5-mC) remained unchanged; after PCR amplification, U was converted to thymine (T), and 5-mC was restored to c. The study found that the V2 promoter region of the SEPT9 gene: in colorectal cancer tissue samples, the base sequence methylation level in this region is the highest; while in normal people or people with other diseases, the base sequence methylation level in this region The base sequence methylation level was the lowest. Therefore, detecting the methylation level of DNA in this region can effectively diagnose colorectal cancer.
[0103] The positive strand nucleotide sequence of the V2 promoter region of SEPT9 DNA is as follows:
[0104] GACCCGCTGCCCACCAGCCATCATGTCGGACCCCGCGGTCAACGCGCAGCTGGATGGGATCATTT.
[0105] The nucleotide sequence of its complementary strand (anti-strand) is as follows:
[0106] AAATGATCCCATCCAGCTGCGCGTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTC.
[0107...
Embodiment 2
[0138] Application of Methylated SEPT9 Gene Detection Kit in Detection of Colorectal Cancer Samples
[0139] SEPT9 gene methylation is a specific molecular marker in the early occurrence and development of CRC. SEPT9 methylation detection can detect more than 70% of early colorectal patients. Using the present invention to simultaneously amplify the positive and negative strands of the SEPT9 gene after bisulfite conversion, a kit for detecting the methylation of the SEPT9 gene can be developed, which can quickly and sensitively detect the methylation of the SEPT9 gene in the sample state. Internal controls such as the ACTB gene can also be added to the kit for monitoring the test results.
[0140] 1. The primer probe sequence of SEPT9: (The primer probe is changed as required by the claims)
[0141] Positive Strand Forward Primer: GATTCGTTGTTTATTAGTTATTATGT
[0142] Forward strand reverse primer: AAATAATCCCATCCAACTA
[0143] Positive strand probe: TTAACCGCGAAATCCGAC
[0...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap