Supercharge Your Innovation With Domain-Expert AI Agents!

Primer and probe used for detecting gene methylation, and sampling method and kit thereof

A methylation and non-methylation technology, used in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve problems such as insufficient sensitivity, and achieve improved sensitivity, clear and objective judgment, and operation. simple effect

Inactive Publication Date: 2017-09-15
SHENZHEN YOU SHENGKANG BIOSCI CO LTD
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Detecting only the positive strand or only the anti-strand will result in insufficient detection sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe used for detecting gene methylation, and sampling method and kit thereof
  • Primer and probe used for detecting gene methylation, and sampling method and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0102] After bisulfite treatment, cytosine was converted to uracil, and 5-methylcytosine (5-mC) remained unchanged; after PCR amplification, U was converted to thymine (T), and 5-mC was restored to c. The study found that the V2 promoter region of the SEPT9 gene: in colorectal cancer tissue samples, the base sequence methylation level in this region is the highest; while in normal people or people with other diseases, the base sequence methylation level in this region The base sequence methylation level was the lowest. Therefore, detecting the methylation level of DNA in this region can effectively diagnose colorectal cancer.

[0103] The positive strand nucleotide sequence of the V2 promoter region of SEPT9 DNA is as follows:

[0104] GACCCGCTGCCCACCAGCCATCATGTCGGACCCCGCGGTCAACGCGCAGCTGGATGGGATCATTT.

[0105] The nucleotide sequence of its complementary strand (anti-strand) is as follows:

[0106] AAATGATCCCATCCAGCTGCGCGTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTC.

[0107...

Embodiment 2

[0138] Application of Methylated SEPT9 Gene Detection Kit in Detection of Colorectal Cancer Samples

[0139] SEPT9 gene methylation is a specific molecular marker in the early occurrence and development of CRC. SEPT9 methylation detection can detect more than 70% of early colorectal patients. Using the present invention to simultaneously amplify the positive and negative strands of the SEPT9 gene after bisulfite conversion, a kit for detecting the methylation of the SEPT9 gene can be developed, which can quickly and sensitively detect the methylation of the SEPT9 gene in the sample state. Internal controls such as the ACTB gene can also be added to the kit for monitoring the test results.

[0140] 1. The primer probe sequence of SEPT9: (The primer probe is changed as required by the claims)

[0141] Positive Strand Forward Primer: GATTCGTTGTTTATTAGTTATTATGT

[0142] Forward strand reverse primer: AAATAATCCCATCCAACTA

[0143] Positive strand probe: TTAACCGCGAAATCCGAC

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer and a probe used for detecting gene methylation, and a sampling method and a kit thereof. The primer comprises a specific methylation forward chain primer and a specific methylation reverse chain primer; the specific forward chain primer comprises a forward chain forward primer and a forward chain reverse primer, and the specific methylation reverse chain primer comprises a reverse chain forward primer and a reverse chain reverse primer; the probe comprises a specific methylation forward chain probe and a specific methylation reverse chain probe; and the primer also comprises a forward chain non-methylation blocking primer and a reverse chain non-methylation blocking primer. The primer, the probe, the sampling method and the kit have the advantages of high specificity, high sensitivity, small pollution, simplicity and fastness in operation, safety, good accuracy and good repeatability of a detection result, and effective improvement of the gene methylation detection condition, and are suitable for clinic use.

Description

technical field [0001] The invention belongs to the field of gene detection, and more specifically relates to a primer, a probe, a sampling method and a kit for gene methylation detection. Background technique [0002] Altered DNA methylation levels and patterns are an important factor in tumorigenesis. After the gene promoter is hypermethylated, the gene expression will be weakened or even turned off, which is equivalent to the switch of the gene. Gene switches in malignant tumors are mostly regulated by DNA methylation. Almost all tumors are accompanied by abnormal changes in DNA methylation, and hypermethylation and hypomethylation often coexist. For example, the promoters of tumor suppressor genes in tumor cells are usually hypermethylated, resulting in the inhibition of tumor suppressor gene expression and loss of tumor suppressor function, thereby promoting the occurrence of cancer. Hypomethylation is usually the hypomethylation of the entire genome or the hypomethyl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6858C12Q2523/125C12Q2563/107C12Q2545/101
Inventor 喻德华梁秋菊
Owner SHENZHEN YOU SHENGKANG BIOSCI CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More