Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of micro RNA31 precursor coded polypeptide to preparation of immunoregulation medicament

An immunomodulatory drug, coding technology, applied in the field of biomedicine

Active Publication Date: 2017-09-19
SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is currently no cure for multiple sclerosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of micro RNA31 precursor coded polypeptide to preparation of immunoregulation medicament
  • Application of micro RNA31 precursor coded polypeptide to preparation of immunoregulation medicament
  • Application of micro RNA31 precursor coded polypeptide to preparation of immunoregulation medicament

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] Example 1. Sequence analysis and in vitro synthesis of miPEP31

[0089] 1. miPEP31 sequence analysis

[0090] The sequence of miR-31 precursor is as follows:

[0091] ACGTAACCTAAAGCTAACAGACGGGGAAGCCATCACCAGGGTTTGGGTTGGATTCCCTACCAGTAAAATGAGGTAATGATGTGAAATTGGTCACGTTGTTGAAGAGTTGAA CTGTTGAACTGAGAACCTGCTATGCCAACATATTGCCATCTTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTTGTCTTGCTACAAGCCATCCATGATATGTAGGGCCCTGTGACTTGGTCTGTCTCGCCCTGACTTCTCTCCAGTCCTATACCGAATCACTCGCTCTGTTCTAGCCACACTGGCCTTTTGGGGATGTTCTTGGCTGCACCAGGAATATTCCCGCCTCTACTGCCCTGTCTTATCTTTTGGGCATCAGTGGAGAACTCTTTCACCATGGCACTGTCTATAAAACCTTACATGTGCCCAGCCACCGTTCACCTCATGACCCTGCTCTGACTTGTCAGAATCATTGGGCACTACCTGTCCATGTTCATTTGCTTAGTTGCTGCTTGATTTACTGTACCAGGTTGTAAGTCCTTTAAGGGACACCCGTCTTCATTTCTGTTCACCATACCCCTAAACCCTGACGTTTGCAAGTCCTCAAGTCATGTCTTTGCGACTCTACCCTGGACTTATTGTGCAACAGAAGTGTCAAATAATGAGATTTTAATCATGCCATGAATGGCTGTGATGAAACACTGGTTTATAAGTAACAAAGAATAAACAAATGCTACTGATTTCTAAGCCTGCAAACCCAACATCTTAAAGGAGCCACAATAAAGTTACCATCAGGTCTACAACTCAGAGAAGACAAAA...

Embodiment 2

[0095] Example 2. Expression of miPEP31 in cells

[0096] The coding sequence of miPEP31 was constructed into the Sal1 / Xhol1 restriction site of plasmid pEGFP-N1 (Addgene). Thus, the obtained heavy plasmid can form a fusion protein of miPEP31 and GFP after expression.

[0097] The recombinant plasmid obtained above was transfected into adipocyte precursor cells (3T3), and the adipocyte somatic cells transformed with the empty plasmid (pEGFP-N1blank) were used as a control. The blank group was only transfected with blank GFP plasmid, and the miPEP31 group was transfected with both miPEP-GFP and GFP empty plasmid.

[0098] Culture the cells, extract the protein and detect the expression of GFP by electrophoresis-immunoblotting method, the results are as follows figure 1 .

[0099] The empty plasmid group can detect the expression of GFP, and the miPEP31 group detects two GFP bands, and one of them has a larger molecular weight, which is miPEP31 fused with GFP.

[0100] In addition, the ...

Embodiment 3

[0103] Example 3. The exogenously synthesized miPEP31 can enter the cell

[0104] The miPEP31 miPEP obtained by the solid-phase polypeptide synthesis method in Example 1 is labeled with FITC at its C terminal.

[0105] 1. 3T3 cells

[0106] 1nM FITC-labeled miPEP31 was co-cultured with 3T3 cells, and the FITC fluorescence of the cells was detected by flow cytometry. The result is image 3 A, FITC signal can be observed in the cells, indicating that miPEP can enter 3T3 cells.

[0107] After 3T3 cells were fixed, the nuclei were stained with DAPI, and then the fluorescence was observed with a laser confocal microscope. The result is image 3 C. The nucleus is stained with DAPI, and blue fluorescence can be observed.

[0108] 3T3 cells were co-cultured with 1nM FITC-labeled miPEP31; after that, the cells were fixed, the nucleus was stained with DAPI, and the fluorescence was observed with a laser confocal microscope. The result is image 3 From D to E, green fluorescence can be observe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of micro RNA31 precursor coded polypeptide to preparation of an immunoregulation medicament. The micro RNA31 precursor coded polypeptide can increase the number of regulatory T cells, and has an immunoregulatory function, so that the micro RNA31 precursor coded polypeptide can be applied to immunoregulation to prevent or treat autoimmune diseases such as multiple sclerosis.

Description

Technical field [0001] The present invention belongs to the field of biomedicine. More specifically, the present invention relates to the application of the polypeptide encoded by the microRNA31 precursor in the preparation of immunomodulatory drugs. Background technique [0002] Regulatory T cells (Regulatory Cells, Treg for short) are a subgroup of T cells that control autoimmune reactivity in the body, and are closely related to the occurrence of autoimmune diseases. Regulatory T cells can be divided into naturally occurring natural regulatory T cells (nTreg) and induced adaptive regulatory T cells (aTreg or iTreg), such as Th3, Tr1, and CD8 Treg, NKT cells. [0003] Studies have shown that Treg and type I diabetes, systemic lupus erythematosus, aplastic anemia, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, multiple sclerosis, inflammatory bowel disease, myasthenia gravis and other diseases closely related. In addition, it is also related to the onset of ma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/00C12N15/11A61K38/16A61P37/02A61P29/00A61P19/02A61P17/06
CPCA61K38/00C07K14/00A61K38/16C12N15/11Y02A50/30
Inventor 王宏林
Owner SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com