Application of micro RNA31 precursor coded polypeptide to preparation of immunoregulation medicament
An immunomodulatory drug, coding technology, applied in the field of biomedicine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0088] Example 1. Sequence analysis and in vitro synthesis of miPEP31
[0089] 1. miPEP31 sequence analysis
[0090] The sequence of miR-31 precursor is as follows:
[0091] ACGTAACCTAAAGCTAACAGACGGGGAAGCCATCACCAGGGTTTGGGTTGGATTCCCTACCAGTAAAATGAGGTAATGATGTGAAATTGGTCACGTTGTTGAAGAGTTGAA CTGTTGAACTGAGAACCTGCTATGCCAACATATTGCCATCTTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTTGTCTTGCTACAAGCCATCCATGATATGTAGGGCCCTGTGACTTGGTCTGTCTCGCCCTGACTTCTCTCCAGTCCTATACCGAATCACTCGCTCTGTTCTAGCCACACTGGCCTTTTGGGGATGTTCTTGGCTGCACCAGGAATATTCCCGCCTCTACTGCCCTGTCTTATCTTTTGGGCATCAGTGGAGAACTCTTTCACCATGGCACTGTCTATAAAACCTTACATGTGCCCAGCCACCGTTCACCTCATGACCCTGCTCTGACTTGTCAGAATCATTGGGCACTACCTGTCCATGTTCATTTGCTTAGTTGCTGCTTGATTTACTGTACCAGGTTGTAAGTCCTTTAAGGGACACCCGTCTTCATTTCTGTTCACCATACCCCTAAACCCTGACGTTTGCAAGTCCTCAAGTCATGTCTTTGCGACTCTACCCTGGACTTATTGTGCAACAGAAGTGTCAAATAATGAGATTTTAATCATGCCATGAATGGCTGTGATGAAACACTGGTTTATAAGTAACAAAGAATAAACAAATGCTACTGATTTCTAAGCCTGCAAACCCAACATCTTAAAGGAGCCACAATAAAGTTACCATCAGGTCTACAACTCAGAGAAGACAAAA...
Embodiment 2
[0095] Example 2. Expression of miPEP31 in cells
[0096] The coding sequence of miPEP31 was constructed into the Sal1 / Xhol1 restriction site of plasmid pEGFP-N1 (Addgene). Thus, the obtained heavy plasmid can form a fusion protein of miPEP31 and GFP after expression.
[0097] The recombinant plasmid obtained above was transfected into adipocyte precursor cells (3T3), and the adipocyte somatic cells transformed with the empty plasmid (pEGFP-N1blank) were used as a control. The blank group was only transfected with blank GFP plasmid, and the miPEP31 group was transfected with both miPEP-GFP and GFP empty plasmid.
[0098] Culture the cells, extract the protein and detect the expression of GFP by electrophoresis-immunoblotting method, the results are as follows figure 1 .
[0099] The empty plasmid group can detect the expression of GFP, and the miPEP31 group detects two GFP bands, and one of them has a larger molecular weight, which is miPEP31 fused with GFP.
[0100] In addition, the ...
Embodiment 3
[0103] Example 3. The exogenously synthesized miPEP31 can enter the cell
[0104] The miPEP31 miPEP obtained by the solid-phase polypeptide synthesis method in Example 1 is labeled with FITC at its C terminal.
[0105] 1. 3T3 cells
[0106] 1nM FITC-labeled miPEP31 was co-cultured with 3T3 cells, and the FITC fluorescence of the cells was detected by flow cytometry. The result is image 3 A, FITC signal can be observed in the cells, indicating that miPEP can enter 3T3 cells.
[0107] After 3T3 cells were fixed, the nuclei were stained with DAPI, and then the fluorescence was observed with a laser confocal microscope. The result is image 3 C. The nucleus is stained with DAPI, and blue fluorescence can be observed.
[0108] 3T3 cells were co-cultured with 1nM FITC-labeled miPEP31; after that, the cells were fixed, the nucleus was stained with DAPI, and the fluorescence was observed with a laser confocal microscope. The result is image 3 From D to E, green fluorescence can be observe...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



