Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid and recombinant plasmid and their preparation method and application

A technology for recombining plasmids and nucleic acids, applied in chemical instruments and methods, biochemical equipment and methods, recombinant DNA technology, etc., can solve the problems of complex preparation methods and low yields, achieve good protein activity, and improve yield and activity.

Inactive Publication Date: 2020-10-16
THE FIRST AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIVERSITY OF PLA
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to overcome the defects of complex preparation method and low yield of bone morphogenetic protein BMP-2 mature peptide in the prior art, and provide a nucleic acid, recombinant plasmid and its preparation method, recombinant strain, and preparation of bone morphogenetic protein Methods and related applications of mature peptides of BMP-2

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid and recombinant plasmid and their preparation method and application
  • Nucleic acid and recombinant plasmid and their preparation method and application
  • Nucleic acid and recombinant plasmid and their preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0034] The present invention also provides a method for preparing the recombinant plasmid, which includes the following steps:

[0035] (1) Provide or prepare a nucleic acid sequence having the sequence shown in SEQ ID NO: 3;

[0036] (2) The nucleic acid sequence with the sequence shown in SEQ ID NO: 3 and the pET30a(+) vector are digested with KpnI and XhoI endonucleases respectively, and the digested products are connected.

[0037] The sequence shown in SEQ ID NO: 3 (including the sequence shown in SEQ ID NO: 1 (underlined part), that is, the nucleic acid sequence encoding the mature peptide of bone morphogenetic protein BMP-2) is:

[0038] CGCCATATGGACGACGACGACAAG CAAGCGAAACACAAACAGCGTAAACGCCTGAAAAGCAGCTGCAAA CGTCATCCGCTGTACGTTGACTTTAGCGACGTCGGTTGGAACGATTGGATTGTTGCACCGCCGGGTTATCACGCATT TTATTGTCACGGCGAGTGTCCGTTTCCGCTGGCAGATCATCTGAATAGCACCAACCACGCGATTGTTCAGACCCTGG TTAACAGCGTTAACAGCAAAATCCCGAAAGCCTGCTGCGTTCCGACCGAACTGTCTGCTATTAGCATGCTGTACCTG GACGAGAACGAGAAAGTCGTCCTGAAAAACTACCAGG...

Embodiment 1

[0057] This example is used to illustrate the construction method of the recombinant plasmid of the present invention

[0058] (1) Double enzyme digestion

[0059] Restriction digestion system of vector pET30a(+)

[0060]

[0061] Target fragment digestion system

[0062]

[0063]

[0064] Note: The target fragment is the nucleic acid of the sequence shown in SEQ ID NO: 3.

[0065] Add the above-mentioned enzyme digestion system components into a centrifuge tube and vortex to mix evenly, and place in a 37°C water bath for 3 hours. Then, the carrier digestion system and the target fragment digestion system are added to 1% by weight agarose gel electrophoresis for separation, and the electrophoresis band that meets the requirements is cut under ultraviolet light. Use a gel recovery kit to recover the bands.

[0066] (2) Enzyme digestion product connection

[0067]

[0068] Add each component to the system, vortex to mix, and water bath at 16°C for 16 hours.

Embodiment 2

[0070] This example is used to illustrate the construction of recombinant strains

[0071] (1) Conversion of ligation products

[0072] Take 100μl of competent E. coli TOP10 into the EP tube, then add 10μl of ligation product, mix gently with a pipette, place on ice for 30min, transfer to 42℃ water bath for 30s, immediately transfer to ice to cool for 2min. Add 500 μl of LB medium to it, and incubate at 37°C and 150r for 1.5 hours. Spread 50μl of the bacterial solution on an LB plate containing Calamycin (50μg / mL) and incubate at 37°C for 14h. A single colony appeared.

[0073] (2) Identification of positive clones

[0074] Pick single bacteria and add to 10μl dd H 2 In O, mix gently with a pipette and perform PCR detection. The PCR system is as follows:

[0075]

[0076] Upstream primer sequence (SEQ ID NO: 9):

[0077] 5’-CAAGCAAGCGAAACACAAACAG-3’

[0078] Downstream primer sequence (SEQ ID NO: 10):

[0079] 3’-CTCAGCGACAACCGCAGCCTT-5’

[0080] PCR reaction conditions: 95°C for 5min; 9...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of protein expression and purification, and discloses nucleic acid, recombinant plasmid and a preparation method and application of the nucleic acid and the recombinant plasmid. The nucleic acid can encode bone morphogenetic protein BMP-2 mature peptide, and is nucleic acid as shown in SEQ ID NO: 1 or nucleic acid as shown in a labeled nucleotide sequence which is connected to a 5' terminal and / or a 3' terminal of SEQ ID NO: 1. According to a plasmid and protein expression and purification method, a codon and a specifically expressed strain are optimized, the high-yield bone morphogenetic protein BMP-2 mature peptide is obtained by specific expression and conditions of protein purification, and the activity of the obtained protein is good.

Description

Technical field [0001] The invention relates to the field of protein expression and purification, in particular to a nucleic acid, a recombinant plasmid, a method for preparing a recombinant plasmid, a recombinant strain, a method for preparing a mature peptide of bone morphogenetic protein BMP-2 and related application. Background technique [0002] Bone morphogenetic protein (BMP) belongs to the transforming growth factor (TGF-β) superfamily, and is a hydrophobic protein secreted by the bone matrix. The mature peptide contains 7 highly conserved cysteines, which form three intrachain disulfide bonds and one interchain disulfide bond and connect the two polypeptide chains into dimers. The BMP family includes BMP-1 and BMP -2, BMP-4, BMP-6, BMP-7, BMP-9, BMP-12 and BMP-14, etc., among which BMP-2 can obviously induce undifferentiated fibroblasts to differentiate into osteoblasts and It can regulate the differentiation of osteoblasts and chondroblasts, induce ectopic bone format...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/51C12N15/70C12N15/66C12N1/21A61K38/18A61P19/08C12R1/19
CPCA61K38/1875C07K14/51C12N15/66C12N15/70
Inventor 周强涂兵罗向东欧阳斌甘翼搏
Owner THE FIRST AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIVERSITY OF PLA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com