Engineering strain for expressing epoxide hydrolase of kidney beans, and application of engineering strain

A technology of epoxide and hydrolase, applied in the field of bioengineering

Inactive Publication Date: 2017-09-26
JIANGNAN UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Enantionormal hydrolysis catalyzed by a single enzyme is the most ideal way to prepare chiral vicinal diols in high yields, but currently only a few EHs have this characteristic for a specific type or type of substrate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering strain for expressing epoxide hydrolase of kidney beans, and application of engineering strain
  • Engineering strain for expressing epoxide hydrolase of kidney beans, and application of engineering strain
  • Engineering strain for expressing epoxide hydrolase of kidney beans, and application of engineering strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Obtaining of Phaseolus epoxide hydrolase gene and construction of expression plasmid

[0028] Specific primers were designed according to the cDNA sequence published by NCBI, PvEH2-F: CATATGATGGAGGGAATACACAGCACAAAG, containing Nde I restriction site, PvEH2-R: CTAGAGTCAAAACTTGTTGATAAAATCAT AAAATGT, containing Not I restriction site. Total RNA was extracted from bean germ. The first strand of cDNA was synthesized by reverse transcription using the total RNA of kidney bean as a template and Oligo dT-Adaptor as a primer; using this strand as a template, PvEH2-F and M13Primer M4 as primers, the first round of PCR was performed: denaturation at 94°C for 2 minutes, 30 Cycle (94°C for 30s, 50°C for 30s, and 72°C for 70s); then use the first-round PCR product as a template and PvEH3-F and PvEH3-R as primers to perform a second round of PCR: denaturation at 94°C for 2 min, 30 cycles ( 94°C for 30s, 52°C for 30s and 72°C for 70s), and 72°C for 10min. The PCR product wa...

Embodiment 2

[0029] Induced expression of embodiment 2 recombinant bacteria

[0030] Inoculate a single colony of E.coli BL21-pveh3 in 2 mL of LB medium containing 100 μg / mL kanamycin, and culture overnight at 37°C and 220 r / min; take 2 mL of the culture medium and transfer it to 100 mL of the same medium, Grow to OD 600 When the concentration is 0.6-0.8, add IPTG (final concentration 0.05mmol / L) and induce at 25°C for 8h. Collect the thalline, use 5mL potassium phosphate buffer solution (K 2 HPO 4 -KH2 PO 4 , 100mmol / L, pH 7.0) to obtain a bacterial suspension with a bacterial concentration of 200mg / mL.

Embodiment 3

[0031] Induction expression temperature optimization of embodiment 3 recombinant bacteria

[0032] According to the method of Example 2, the difference is that the induction temperature is adjusted to 16-35°C. Such as figure 1 As shown, when the temperature increased from 16°C to 22°C, the relative enzyme activity also increased. When the temperature continued to increase, the relative enzyme activity began to decrease, and when the temperature was 35°C, the relative enzyme activity was only 60% of that at 22°C. It shows that the optimum induction temperature is 22℃.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an engineering strain for expressing epoxide hydrolase of kidney beans, and application of the engineering strain, belonging to the field of biological engineering technology. The invention provides the epoxide hydrolase and recombinant escherichia coli for expressing the epoxide hydrolase. The epoxide hydrolase provided by the invention can catalyze racemic p-chloro-epoxyethylbenzene (rac-pCSO) to generate (R)-p-chloro-phenyl ethylene glycol (pCPED); when the conversion rate reaches 99.7%, an enantiomer excess value of the product is 85.1%eep. Compared with other plant-derived epoxide hydrolases, the epoxide hydrolase provided by the invention increases the value by 10 times.

Description

technical field [0001] The invention relates to an engineering bacterium expressing kidney bean epoxide hydrolase and its application, belonging to the technical field of bioengineering. Background technique [0002] Epoxide hydrolases (EHs) can hydrolyze kinetically resolved and enantionormalized hydrolysis of racemic epoxides to generate optically active epoxides or single-configuration vicinal diols, due to their source Widely, the whole cell can be catalyzed and does not require the participation of metal ions and coenzymes, and has attracted extensive attention. Chiral epoxides and vicinal diols are important intermediates for the synthesis of chiral compounds, and have important application values ​​in the synthesis of medicine, pesticides and functional materials, such as p-chlorostyrene oxide ((R)-pCSO ) and p-chlorophenylethylene glycol ((R)-pCPED) are important intermediates in the synthesis of the neuroprotective agent ilirodide. As a glutamate antagonist, elirod...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/14C12N15/55C12N1/21C12N15/70C12P7/22C12R1/19
CPCC12N9/14C12P7/22C12Y303/02003
Inventor邬敏辰王瑞宗迅成阚婷婷刘艳
OwnerJIANGNAN UNIV