Epoxy hydrolase, gene thereof and application thereof

An epoxy hydrolase and gene technology, applied in the field of bioengineering, can solve the problems of narrow substrate spectrum, low enzyme yield, low overall catalytic activity, etc., and achieve the effects of mild reaction conditions, high catalytic efficiency and environmental friendliness.

Active Publication Date: 2011-11-16
SUZHOU BAIFUAN ENZYME TECH
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The technical problem to be solved by the present invention is that when the whole cell of wild-type Bacillus megaterium (B. megaterium) is used to catalyze the asymmetric hydrolysis of glycidyl aryl ether, the enzyme yield is low, resulting in low overall catalytic activity and narrow substrate spectrum. To provide a high catalytic activity, strong enantioselectivity, wide substrate applicability, environmentally friendly epoxy hydrolase and its gene, and a recombinant expression vector containing the gene and a recombinant expression transformant, the recombinant enzyme The preparation method of, and the application of this recombinant epoxy hydrolase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Epoxy hydrolase, gene thereof and application thereof
  • Epoxy hydrolase, gene thereof and application thereof
  • Epoxy hydrolase, gene thereof and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Cloning of Epoxyhydrolase Gene

[0044] According to the B. megaterium (B. megaterium) QM B1551 hydrolase gene sequence BMQ_2920 and B. cereus (B. cereus) ATCC 10987 hydrolase gene sequence BCE_0353 included in Genbank, the PCR primers were designed as follows:

[0045] Primer 1 (amplification of BMEH I gene):

[0046] Upstream primer: CAC GGATCC ATGAGTAAACAGTATATAAACGT

[0047] Downstream primer: GGC GTC GAC TTACTTATTTAAAAAATTCCACAT

[0048] Primer 2 (amplification of BMEH II gene):

[0049] Upstream primer: CAC GGATCC ATGGAGAAAGTAAAAGCAATACT

[0050] Downstream primer: GGC GTC GAC TTACACATTAGACTTTCCTTTTTC

[0051] Wherein, the underlined part of the upstream primer is the BamHI restriction site, and the underlined part of the downstream primer is the SalI restriction site.

[0052] Using the genomic DNA of B. megaterium (B. megaterium) CGMCC No.1293 as a template, PCR amplification was performed with primer 1 and primer 2, respectively. The PCR s...

Embodiment 2

[0055] Embodiment 2 Preparation of recombinant expression vector (plasmid) and recombinant expression transformant

[0056]The PCR product obtained in Example 1 was ligated with the pMD-18T vector to construct cloning plasmids pBMEHI-18T and pBMEHII-18T, respectively. Then they were transformed into E.coli DH5α competent cells. Positive clones were screened by colony PCR, plasmids were extracted, digested with restriction endonucleases BamHI and SalI at 37°C for 12 hours, purified by agarose gel electrophoresis, and the target fragment was recovered using an agarose gel DNA recovery kit, which contained The correct insert (see respectively image 3 and Figure 4 ). The target fragment was mixed with the plasmid pET28a digested with BamHI and SalI, and ligated overnight at 4°C under the action of T4 DNA ligase to obtain recombinant expression plasmids pET-BMEHI and pET-BMEHII.

[0057] The above recombinant expression plasmids were transformed into E.coli DH5α competent cel...

Embodiment 3

[0058] Example 3 Expression of Recombinant Epoxyhydrolase

[0059] The two strains of recombinant Escherichia coli obtained in Example 2 were respectively inoculated into LB medium containing kanamycin, and cultured with shaking at 37° C. overnight. Insert the inoculum amount of 1% (v / v) into a 250ml Erlenmeyer flask equipped with 50ml LB medium (peptone 10g / L, yeast extract 5g / L, NaCl 10g / L, pH 7.0), place at 37°C, 180rpm Culture on a shaker. When the OD of the culture medium 600 When reaching 0.6, add IPTG with a final concentration of 0.5mmol / L as an inducer. After induction at 16°C for 20 h, the culture medium was centrifuged to collect the cells and washed twice with saline. The resulting resting cells were suspended in 100 mmol / L, pH 7.0 phosphate buffer, and ultrasonically disrupted in an ice bath (power 400W, working 6s, interval 4s, sonicating 99 times). Centrifuge at 8800rpm for 20min to collect the supernatant, which is the crude enzyme solution of the recombina...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel epoxy hydrolase, a gene of the epoxy hydrolase, a recombination expressor and a recombination expression transformant containing the gene, a method for preparing a recombinase by using the recombination expression transformant, and an application of the recombined epoxy hydrolase in catalyzing racemic epoxide enantioselective hydrolysis for producing chiral epoxideand diol. The recombined epoxy hydrolase provided by the invention is originated from bacillus megaterium. The epoxy hydrolase can be used for synthesizing various optically active epoxides and vicinal diols. The epoxy hydrolase has advantages of high catalysis efficiency, high enantioselectivity, and mild reaction condition. The epoxy hydrolase is environment-friendly. Compared with wild bacterium whole cells, the epoxy hydrolase provided by the invention contributes to a better catalysis effect and a better applicability of substrates. The epoxy hydrolase has a good prospect to be applied in industrial productions.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a novel epoxy hydrolase and its gene, a recombinant expressor and a recombinant expression transformant containing the gene, a method for preparing a recombinant enzyme using a recombinant expression transformant, and the recombinant loop Use of oxygen hydrolases to catalyze the enantioselective hydrolysis of racemic epoxides to produce chiral epoxides. Background technique [0002] Optically active epoxides and their hydrolysis products ortho-diols are widely used in the synthesis of chiral compounds, and have extremely important application values ​​in the industries of medicine, pesticides, ferroelectric liquid crystals, spices, and fine chemicals, such as ( Glycidyl aryl ether in S)-configuration is an intermediate in the synthesis of chiral amino alcohols and biologically active substances (such as β-receptor blockers) (Curr. Med. Chem. 2007, 14: 53-65). ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/14C12N15/55C12N15/63C12N1/21C12P41/00C12P17/02C12R1/11C12R1/19
Inventor许建和赵晶李爱涛潘江
OwnerSUZHOU BAIFUAN ENZYME TECH