Unlock instant, AI-driven research and patent intelligence for your innovation.

Single-stranded probe preparation method for multigene capture sequencing

A multi-gene and probe technology, applied in biochemical equipment and methods, DNA preparation, microbial measurement/inspection, etc., can solve problems such as hybridization efficiency reduction

Active Publication Date: 2021-09-14
JIANGSU MICRODIAG BIOMEDICINE TECH CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with single-stranded probes from Agilent, Roche and IDT, hybridization efficiency is greatly reduced

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single-stranded probe preparation method for multigene capture sequencing
  • Single-stranded probe preparation method for multigene capture sequencing
  • Single-stranded probe preparation method for multigene capture sequencing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] The following will clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only some of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.

[0050] Materials: synthetic chip (Custom Array Company), DNA to be tested (interrupted tissue sample DNA)

[0051] Instruments: ordinary PCR instrument (MG96G), magnetic frame (BioMag), electrophoresis instrument, Nanodrop spectrophotometer, next-generation sequencer (illumina)

[0052] Reagents: DNA polymerase (Roche), 10×PCR Buffer (Roche), MgCl2 (Roche), dNTP (TaKaRa), dUTP (TaKaRa), UDG enzyme (NEB), purified water.

[0053] Single-stranded probe preparation process:

[0054] (1) Chip synthesis: synthesize a chip...

Embodiment 2

[0110] Material, instrument, reagent are with embodiment 1

[0111] Single-stranded probe preparation process:

[0112] (1) chip synthesis: synthesize a chip with 60K oligonucleotides, the chip contains 80bp-120bp target region and common base ends at both ends: 16 bases are connected to the 5' end, and 16 bases are connected to the 3' end 17 bases, the chip is a chip containing the KRAS gene in the target region, and the specific sequence is shown in SEQ ID NO.8:

[0113]5′-GACGCCGTGTAGCGATCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCACCAGCTCCAACTACCACAAGTTTATATTCAGTCATTTTCAGCAGGCCTTATTGCATCGAGTGCACGG-3′;

[0114] (2) Chip DNA elution: The oligonucleotide library synthesized on the chip was eluted and dissolved in 80 μL of TE. The concentration of each oligonucleotide was at the fmol level, and amplified to obtain the desired concentration.

[0115] (3) Chip DNA amplification: the specific sequence of the primers required in the PCR reaction is:

[0116] Primer F SEQ ID NO.3: 5′...

Embodiment 3

[0167] Material, instrument, reagent are with embodiment 1

[0168] Single-stranded probe preparation process:

[0169] (1) chip synthesis: synthesize a chip with 90K oligonucleotides, the chip contains 80bp-120bp target region and common base ends at both ends, wherein 18 bases are connected to the 5' end, and 18 bases are connected to the 3' end 16 bases, the chip is a chip containing the BRAF gene in the target region, and the specific sequence is shown in SEQ ID NO.9:

[0170] 5′-GCTCGCGAGCACGATCTATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAAATCACCTATTTTACTGTGAGGTCTTCATGAAGAACGTACGTGTGTACGA-3′;

[0171] (2) Chip DNA elution: The oligonucleotide library synthesized on the chip was eluted and dissolved in 80 μL of TE. The concentration of each oligonucleotide was at the fmol level, and amplified to obtain the desired concentration.

[0172] (3) Chip DNA amplification: the specific sequence of the primers required in the PCR reaction is:

[0173] Pri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing a single-stranded probe for multi-gene capture sequencing. The method comprises the following steps: 1. Chip synthesis, 2. Chip DNA elution, 3. Using a dUTP-containing PCR reaction system to amplify the chip DNA, 4. Purify the PCR product with magnetic beads. 5. Use a single primer for biased amplification. The 5' end of the primer is labeled with biotin to obtain a hybrid double-stranded DNA containing a single strand of biotin and a strand containing dUTP. The enzyme that recognizes and excises dUTP digests the dUTP-containing parent chain in step 5. 7. Purifies the digested product to obtain a biotin-labeled single-stranded probe. 8. Dilute to the required concentration and store in aliquots . Compared with commercially available synthetic probes, the enzymatic method has mild reaction conditions, lower cost and easy promotion.

Description

technical field [0001] The invention belongs to the field of biology, and in particular relates to a single-stranded probe preparation method for multi-gene capture sequencing. Background technique [0002] Hybridization-based target sequence capture technology is mainly divided into solid-phase hybridization and liquid-phase hybridization according to the state of hybridization. Solid-phase hybridization sequence capture technology is a high-throughput sequence capture technology in which oligonucleotide probes are synthesized on a chip and hybridized on the chip, which can capture the entire exon or even a larger region on a chip . However, because the amount of oligonucleotides on the chip is small, a larger sample input volume is required to promote hybridization. The liquid-phase hybridization is through the direct hybridization of the target DNA fragment and the biotin-labeled probe in the solution, and then the target DNA fragment is anchored on the microbead with a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/10C12Q1/6811
CPCC12Q1/6806C12Q2525/117C12Q2563/143C12Q2563/149C12Q2565/519
Inventor 王弢官民晓巴兆粉陆亚红
Owner JIANGSU MICRODIAG BIOMEDICINE TECH CO LTD