Single-stranded probe preparation method for multigene capture sequencing
A multi-gene and probe technology, applied in biochemical equipment and methods, DNA preparation, microbial measurement/inspection, etc., can solve problems such as hybridization efficiency reduction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] The following will clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only some of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.
[0050] Materials: synthetic chip (Custom Array Company), DNA to be tested (interrupted tissue sample DNA)
[0051] Instruments: ordinary PCR instrument (MG96G), magnetic frame (BioMag), electrophoresis instrument, Nanodrop spectrophotometer, next-generation sequencer (illumina)
[0052] Reagents: DNA polymerase (Roche), 10×PCR Buffer (Roche), MgCl2 (Roche), dNTP (TaKaRa), dUTP (TaKaRa), UDG enzyme (NEB), purified water.
[0053] Single-stranded probe preparation process:
[0054] (1) Chip synthesis: synthesize a chip...
Embodiment 2
[0110] Material, instrument, reagent are with embodiment 1
[0111] Single-stranded probe preparation process:
[0112] (1) chip synthesis: synthesize a chip with 60K oligonucleotides, the chip contains 80bp-120bp target region and common base ends at both ends: 16 bases are connected to the 5' end, and 16 bases are connected to the 3' end 17 bases, the chip is a chip containing the KRAS gene in the target region, and the specific sequence is shown in SEQ ID NO.8:
[0113]5′-GACGCCGTGTAGCGATCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCACCAGCTCCAACTACCACAAGTTTATATTCAGTCATTTTCAGCAGGCCTTATTGCATCGAGTGCACGG-3′;
[0114] (2) Chip DNA elution: The oligonucleotide library synthesized on the chip was eluted and dissolved in 80 μL of TE. The concentration of each oligonucleotide was at the fmol level, and amplified to obtain the desired concentration.
[0115] (3) Chip DNA amplification: the specific sequence of the primers required in the PCR reaction is:
[0116] Primer F SEQ ID NO.3: 5′...
Embodiment 3
[0167] Material, instrument, reagent are with embodiment 1
[0168] Single-stranded probe preparation process:
[0169] (1) chip synthesis: synthesize a chip with 90K oligonucleotides, the chip contains 80bp-120bp target region and common base ends at both ends, wherein 18 bases are connected to the 5' end, and 18 bases are connected to the 3' end 16 bases, the chip is a chip containing the BRAF gene in the target region, and the specific sequence is shown in SEQ ID NO.9:
[0170] 5′-GCTCGCGAGCACGATCTATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAAATCACCTATTTTACTGTGAGGTCTTCATGAAGAACGTACGTGTGTACGA-3′;
[0171] (2) Chip DNA elution: The oligonucleotide library synthesized on the chip was eluted and dissolved in 80 μL of TE. The concentration of each oligonucleotide was at the fmol level, and amplified to obtain the desired concentration.
[0172] (3) Chip DNA amplification: the specific sequence of the primers required in the PCR reaction is:
[0173] Pri...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


