A kind of RNAi carrier and application thereof for gene silencing of Nannochloropsis
A kind of Nannochloropsis, gene silencing technology, applied in the field of microbial genetic engineering, can solve problems such as the difficulty of establishing homologous recombination methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Obtaining the complete sequence of Nannochloropsis oceanica IMET1 carbonic anhydrase (gene number: g2209)
[0039] By sequencing the whole genome of Nannochloropsis, the whole sequence of carbonic anhydrase (g2209) encoded by nuclear genome was preliminarily obtained, as shown in SEQ ID No.1 and SEQ ID No.2.
[0040] The complete reading frame (ORF) of its carbonic anhydrase was further verified by polymerase chain reaction PCR. The PCR primer sequence was: F1 was 5'ATGAGCGTACAGGCAGTGCGAG3'; R1 was 5'CTACTCAGACAGCTTCGCCTTC3'. The PCR reaction system includes 5XPCR reaction buffer (5X DNA buffer) 5ul, deoxyribonucleoside triphosphate (dNTP) 4ul, magnesium sulfate (MgSO 4 ) 2ul, forward primer (Forward primer) 2ul, reverse primer (Reverse primer) 2ul, DNA 3ul, DNA polymerase (KOD DNApoleymase) 0.5ul, ddH 2 O is 32.5ul, and the total reaction system is 50ul;
[0041] The PCR reaction program was the first step at 95°C for 5 min, the second step at 95°C for 1 mi...
Embodiment 2
[0043] 1) Construction of RNAi expression vector
[0044] The construction of the RNAi expression vector takes phir-PtGUS as the carrier backbone. First, the Nannochloropsis genome is used as a template by PCR amplification reaction to amplify a 208bp fragment (CA-2209 gene sequence 195bp to 413bp position) and a 404bp fragment (CA2 Gene sequence 195bp to 599bp position) two PCR fragments;
[0045] Wherein, the primers for amplifying the 208bp fragment are:
[0046] CA2209_Fw (5'CGGAATTCATTTTTCGTGCCTGCGTTT3'; contains EcoRI site) / CA2209_Rv1 (5'GCTCTAGATGGTCTAAATGTCGATTGTTCG3'; contains XbaI site);
[0047] The primers for amplifying the 404bp fragment are:
[0048] CA2209_Fw (5'CGGAATTCATTTTTCGTGCCTGCGTTT3'; contains EcoRI site) / CA2209_Rv2 (5'GCTCTAGAGCTCCTTGTGCTTCTCCGTA3'; contains XbaI site).
[0049] The above reaction systems for PCR amplification are all 50ul: including 5XPCR reaction buffer (5X DNA buffer) 5ul, deoxyribonucleoside triphosphate (dNTP) 4ul, magnesium su...
Embodiment 3
[0058] The PCR verification of embodiment 3 transformants
[0059] Pick the transformant with a toothpick and place it in fresh f / 2 medium (containing 3-5ug / ml Zeocin antibiotic), culture it in a light incubator, wait for it to grow for 2-3 weeks, collect the algal cells by centrifugation, and use genomic DNA extraction reagent The genomic DNA of the transformant was extracted using the OMEGA HP DNAextration kit, and the genomic DNA of the wild-type Nannochloropsis was also extracted as a control for subsequent experiments. After the genome was extracted and quantified by Nannodrop, the PCR amplification reaction was carried out with the forward primer F1 (5'TTATCAACGGCATACCGGCACTG3') and the reverse primer R1 (5'CTGATGAACAGGGTCACGTCGT3'). The reaction system was 50ul: 5X PCR reaction buffer (5X DNA buffer) 5ul , deoxyribonucleoside triphosphate (dNTP) 4ul, magnesium sulfate (MgSO 4 ) 2ul, forward primer (primer F1) 2ul, reverse primer (primer R1) 2ul, template DNA (DNA) 3ul,...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More