Method for suppressing insect gene expression by short single-stranded DNA
A gene expression and insect technology, applied in recombinant DNA technology, other methods of inserting foreign genetic materials, and the use of microinjection methods, etc. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] 1. The Plutella xylostella tanning hormone α subunit gene was determined as the target gene, and a pair of primers were designed using the Plutella xylostella xylostella tanninizing hormone α subunit gene in the Plutella xylostella genome database as a template.
[0033] Upstream primer 01F: 5'- GATTTAACTGTTTGTCAAATGCA -3'
[0034] Upstream primer 01R: 5'- ACACTGATCAAGAGATTTATTATAGT -3'
[0035] PCR was carried out with the above primers, and a PCR product of about 750bp (including part of 5'UTR and 3'UTR) was obtained. 1shown.
[0036] 2. According to the sequencing results, one fragment (E2 and I1, with sequences such as SEQ ID NO. 2 - 3) was designed in the exon and intron regions, and the two designed short single-stranded DNA fragments (E2 and I1) were sent to Platinum Shang company synthesis. The two short single-stranded DNA fragments synthesized above were diluted with nucleic acid-free water to 0.45 nmol / μl.
[0037] Using a needle puller, the capillary g...
Embodiment 2
[0050] 1. The Plutella xylostella arginine kinase gene was determined as the target gene, and a pair of primers were designed using the Plutella xylostella arginine kinase (AK) gene in the Plutella xylostella genome database as a template.
[0051] Upstream primer 01F: 5'-GCACTTCAGGTTCAGGCTCG -3'
[0052] Upstream primer 01R: 5'-CCGACCGCACTTCCAATACTTACC -3'
[0053] PCR was carried out with the above primers to obtain a PCR product of 3579 bp. 4shown.
[0054] 2. According to the sequencing results, a DNA fragment AK-E2 (SEQ ID NO. 5) and AK-I3 (SEQ ID NO. 6) were designed in the exon and intron regions respectively, and sent to Boshang Company for synthesis. The synthesized short single-stranded DNA fragments (AK-E2 and AK-I3) were respectively dissolved in nucleic acid-free water to a solution of 0.25 nmol / μl.
[0055] Using a needle puller, the capillary glass tube was made into a microinjection needle by one-step method (the temperature of the two-step method was set ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com