Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for suppressing insect gene expression by short single-stranded DNA

A gene expression and insect technology, applied in recombinant DNA technology, other methods of inserting foreign genetic materials, and the use of microinjection methods, etc. Effect

Active Publication Date: 2017-10-24
FUJIAN AGRI & FORESTRY UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, although short single-stranded DNA has been found to inhibit gene expression in some organisms, it has not been reported in insects so far.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for suppressing insect gene expression by short single-stranded DNA
  • Method for suppressing insect gene expression by short single-stranded DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] 1. The Plutella xylostella tanning hormone α subunit gene was determined as the target gene, and a pair of primers were designed using the Plutella xylostella xylostella tanninizing hormone α subunit gene in the Plutella xylostella genome database as a template.

[0033] Upstream primer 01F: 5'- GATTTAACTGTTTGTCAAATGCA -3'

[0034] Upstream primer 01R: 5'- ACACTGATCAAGAGATTTATTATAGT -3'

[0035] PCR was carried out with the above primers, and a PCR product of about 750bp (including part of 5'UTR and 3'UTR) was obtained. 1shown.

[0036] 2. According to the sequencing results, one fragment (E2 and I1, with sequences such as SEQ ID NO. 2 - 3) was designed in the exon and intron regions, and the two designed short single-stranded DNA fragments (E2 and I1) were sent to Platinum Shang company synthesis. The two short single-stranded DNA fragments synthesized above were diluted with nucleic acid-free water to 0.45 nmol / μl.

[0037] Using a needle puller, the capillary g...

Embodiment 2

[0050] 1. The Plutella xylostella arginine kinase gene was determined as the target gene, and a pair of primers were designed using the Plutella xylostella arginine kinase (AK) gene in the Plutella xylostella genome database as a template.

[0051] Upstream primer 01F: 5'-GCACTTCAGGTTCAGGCTCG -3'

[0052] Upstream primer 01R: 5'-CCGACCGCACTTCCAATACTTACC -3'

[0053] PCR was carried out with the above primers to obtain a PCR product of 3579 bp. 4shown.

[0054] 2. According to the sequencing results, a DNA fragment AK-E2 (SEQ ID NO. 5) and AK-I3 (SEQ ID NO. 6) were designed in the exon and intron regions respectively, and sent to Boshang Company for synthesis. The synthesized short single-stranded DNA fragments (AK-E2 and AK-I3) were respectively dissolved in nucleic acid-free water to a solution of 0.25 nmol / μl.

[0055] Using a needle puller, the capillary glass tube was made into a microinjection needle by one-step method (the temperature of the two-step method was set ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for suppressing insect gene expression by short single-stranded DNA. The method comprises the following steps: 1) determining an insect target gene, performing PCR (polymerase chain reaction) amplification to obtain a DNA sequence of an insect target gene, and performing sequencing; 2) designing a short single-stranded DNA fragment according to the DNA sequence obtained in step 1); 3) diluting the short single-stranded DNA fragment obtained in step 2), and injecting the short single-stranded DNA fragment into an insect body by microinjection; 4) performing RT-qPCR detection on expression of the insect target gene in step 3) to determine the relative expression level of the inset target gene.

Description

technical field [0001] The invention relates to a method for inhibiting insect gene expression by using short single-stranded DNA, which belongs to the field of biotechnology. Background technique [0002] Homology-dependent gene silencing is widely used in the research of molecular biology, which mainly reduces the synthesis of protein by reducing the transcription product, thus making it lose its original function. Most of the homologous fragments currently used to regulate gene expression are antisense RNA and double-stranded RNA; with the discovery of research, the introduction of DNA fragments can also cause gene silencing, which is called DNA interference. [0003] The study pointed out that after introducing NgAgo protein into zebrafish, it was found that after injecting the DNA fragment of the endogenous gene, the expression of the target gene would be inhibited, but it would not cause gene mutation (Qi J, Dong Z, Shi Y, et al. NgAgo-based fabp11a gene knockdown...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/89
CPCC12N15/89
Inventor 杨广陈金芝芮祥云黄鹏榕尤民生
Owner FUJIAN AGRI & FORESTRY UNIV