Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for quickly detecting CYP2C19 gene polymorphism based on pyrosequencing technique

A technology of CYP2C19 and pyrosequencing, applied in the field of molecular biology testing, achieves the effect of low cost and low detection cost

Inactive Publication Date: 2017-10-24
GUIZHOU PROVINCIAL PEOPLES HOSPITAL
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, clinically, some patients will develop clopidogrel resistance[4], and there will still be cardiovascular thrombotic events

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quickly detecting CYP2C19 gene polymorphism based on pyrosequencing technique
  • Method for quickly detecting CYP2C19 gene polymorphism based on pyrosequencing technique
  • Method for quickly detecting CYP2C19 gene polymorphism based on pyrosequencing technique

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0080] A method for rapid detection of CYP2C19 gene polymorphism based on pyrosequencing technology, comprising the following steps:

[0081] S1: Genomic DNA extraction: Take 200 μL of whole blood, extract genomic DNA with a DNA extraction kit, test the concentration and purity of the DNA sample, and store it at -20°C for later use;

[0082] S2: Primer design for CYP2C19 polymorphism site:

[0083] Download the 1 kb gene sequence of CYP2C19*2 (rs4244285), CYP2C19*3 (rs4986893), and CYP2C19*17 (rs12248560) from NCBI, and design PCR using PyroMark Assay DesignSoftware2.0 (Qiagen, Germany) Primers and Pyrosequencing Primers:

[0084] PCR primers include:

[0085] PCR primer 1 (SEQNO1):

[0086] CYP2C19*2 (rs4244285) upstream primer 5'Biotin-CCAGAGCTTGGCATATTGTATCTA;

[0087] PCR primer 2 (SEQNO2):

[0088] CYP2C19*2 (rs4244285) downstream primer CGCAAGCAGTCACATAACTAAGC;

[0089] PCR primer 3 (SEQNO3):

[0090] CYP2C19*3 (rs4986893) upstream primer 5'Biotin-TCCCTGCAATGTGATC...

Embodiment 2

[0137] A method for rapid detection of CYP2C19 gene polymorphism based on pyrosequencing technology, comprising the following steps:

[0138] S1: Genomic DNA extraction: Take 200 μL of whole blood, extract genomic DNA with a DNA extraction kit, test the concentration and purity of the DNA sample, and store it at -20°C for later use;

[0139] S2: Primer design for CYP2C19 polymorphism site:

[0140] Download the 1 kb gene sequence of CYP2C19*2 (rs4244285), CYP2C19*3 (rs4986893), and CYP2C19*17 (rs12248560) from NCBI, and design PCR using PyroMark Assay DesignSoftware2.0 (Qiagen, Germany) Primers and Pyrosequencing Primers:

[0141] PCR primers include:

[0142] PCR primer 1 (SEQNO1):

[0143] CYP2C19*2 (rs4244285) upstream primer 5'Biotin-CCAGAGCTTGGCATATTGTATCTA;

[0144] PCR primer 2 (SEQNO2):

[0145] CYP2C19*2 (rs4244285) downstream primer CGCAAGCAGTCACATAACTAAGC;

[0146] PCR primer 3 (SEQNO3):

[0147] CYP2C19*3 (rs4986893) upstream primer 5'Biotin-TCCCTGCAATGTGATC...

Embodiment 3

[0194] A method for rapid detection of CYP2C19 gene polymorphism based on pyrosequencing technology, comprising the following steps:

[0195] S1: Genomic DNA extraction: Take 200 μL of whole blood, extract genomic DNA with a DNA extraction kit, test the concentration and purity of the DNA sample, and store it at -20°C for later use;

[0196] S2: Primer design for CYP2C19 polymorphism site:

[0197] Download the 1 kb gene sequence of CYP2C19*2 (rs4244285), CYP2C19*3 (rs4986893), and CYP2C19*17 (rs12248560) from NCBI, and design PCR using PyroMark Assay DesignSoftware2.0 (Qiagen, Germany) Primers and Pyrosequencing Primers:

[0198] PCR primers include:

[0199] PCR primer 1 (SEQNO1):

[0200] CYP2C19*2 (rs4244285) upstream primer 5'Biotin-CCAGAGCTTGGCATATTGTATCTA;

[0201] PCR primer 2 (SEQNO2):

[0202] CYP2C19*2 (rs4244285) downstream primer CGCAAGCAGTCACATAACTAAGC;

[0203] PCR primer 3 (SEQNO3):

[0204] CYP2C19*3 (rs4986893) upstream primer 5'Biotin-TCCCTGCAATGTGATC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Diameteraaaaaaaaaa
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for quickly detecting CYP2C19 gene polymorphism based on a pyrosequencing technique. The method comprises the following steps: S1) extraction for genome DNA; S2) primer design for CYP2C19 gene polymorphic site; S3) PCR amplified reaction; S4) pyrosequencing; S5) genotype analysis; S6) Sanger sequencing verification. The primer of the CYP2C19 gene polymorphic site includes the gene sequences and pyrosequencing primers in 1kb scope upstream and downstream the CYP2C19*2(rs4244285), CYP2C19*3(rs4986893) and CYP2C19*17 (rs12248560) sites. The method for quickly detecting CYP2C19 gene polymorphism established by the invention can be used for quickly and accurately parting CYP2C19 genes and has the characteristics of high speed, accuracy and low cost.

Description

technical field [0001] The invention relates to the technical field of molecular biology testing, in particular to a method for rapid detection of CYP2C19 gene polymorphism based on pyrosequencing technology. Background technique [0002] In addition to the gold standard Sanger sequencing technology, methods for detecting CYP2C19 polymorphisms include restriction fragment length polymorphism analysis, time-of-flight mass spectrometry [6], DNA microarray chips, high-resolution melting curve analysis, Taqman probes, etc. Technology [10]. These techniques have high accuracy for CYP2C19 genotyping, but all have some shortcomings, the operation steps are relatively cumbersome, or need to rely on expensive instruments, the detection cost is high, and they are not suitable for large-scale promotion and application. In order to meet the clinical needs of CYP2C19 gene polymorphism detection, it is necessary to establish an efficient, rapid, high accuracy, good sensitivity, economica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6869C12Q2565/301C12Q2527/125
Inventor 黄盛文徐琴杨楠楠韩媛媛李頔
Owner GUIZHOU PROVINCIAL PEOPLES HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com