Method for quickly detecting CYP2C19 gene polymorphism based on pyrosequencing technique
A technology of CYP2C19 and pyrosequencing, applied in the field of molecular biology testing, achieves the effect of low cost and low detection cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0080] A method for rapid detection of CYP2C19 gene polymorphism based on pyrosequencing technology, comprising the following steps:
[0081] S1: Genomic DNA extraction: Take 200 μL of whole blood, extract genomic DNA with a DNA extraction kit, test the concentration and purity of the DNA sample, and store it at -20°C for later use;
[0082] S2: Primer design for CYP2C19 polymorphism site:
[0083] Download the 1 kb gene sequence of CYP2C19*2 (rs4244285), CYP2C19*3 (rs4986893), and CYP2C19*17 (rs12248560) from NCBI, and design PCR using PyroMark Assay DesignSoftware2.0 (Qiagen, Germany) Primers and Pyrosequencing Primers:
[0084] PCR primers include:
[0085] PCR primer 1 (SEQNO1):
[0086] CYP2C19*2 (rs4244285) upstream primer 5'Biotin-CCAGAGCTTGGCATATTGTATCTA;
[0087] PCR primer 2 (SEQNO2):
[0088] CYP2C19*2 (rs4244285) downstream primer CGCAAGCAGTCACATAACTAAGC;
[0089] PCR primer 3 (SEQNO3):
[0090] CYP2C19*3 (rs4986893) upstream primer 5'Biotin-TCCCTGCAATGTGATC...
Embodiment 2
[0137] A method for rapid detection of CYP2C19 gene polymorphism based on pyrosequencing technology, comprising the following steps:
[0138] S1: Genomic DNA extraction: Take 200 μL of whole blood, extract genomic DNA with a DNA extraction kit, test the concentration and purity of the DNA sample, and store it at -20°C for later use;
[0139] S2: Primer design for CYP2C19 polymorphism site:
[0140] Download the 1 kb gene sequence of CYP2C19*2 (rs4244285), CYP2C19*3 (rs4986893), and CYP2C19*17 (rs12248560) from NCBI, and design PCR using PyroMark Assay DesignSoftware2.0 (Qiagen, Germany) Primers and Pyrosequencing Primers:
[0141] PCR primers include:
[0142] PCR primer 1 (SEQNO1):
[0143] CYP2C19*2 (rs4244285) upstream primer 5'Biotin-CCAGAGCTTGGCATATTGTATCTA;
[0144] PCR primer 2 (SEQNO2):
[0145] CYP2C19*2 (rs4244285) downstream primer CGCAAGCAGTCACATAACTAAGC;
[0146] PCR primer 3 (SEQNO3):
[0147] CYP2C19*3 (rs4986893) upstream primer 5'Biotin-TCCCTGCAATGTGATC...
Embodiment 3
[0194] A method for rapid detection of CYP2C19 gene polymorphism based on pyrosequencing technology, comprising the following steps:
[0195] S1: Genomic DNA extraction: Take 200 μL of whole blood, extract genomic DNA with a DNA extraction kit, test the concentration and purity of the DNA sample, and store it at -20°C for later use;
[0196] S2: Primer design for CYP2C19 polymorphism site:
[0197] Download the 1 kb gene sequence of CYP2C19*2 (rs4244285), CYP2C19*3 (rs4986893), and CYP2C19*17 (rs12248560) from NCBI, and design PCR using PyroMark Assay DesignSoftware2.0 (Qiagen, Germany) Primers and Pyrosequencing Primers:
[0198] PCR primers include:
[0199] PCR primer 1 (SEQNO1):
[0200] CYP2C19*2 (rs4244285) upstream primer 5'Biotin-CCAGAGCTTGGCATATTGTATCTA;
[0201] PCR primer 2 (SEQNO2):
[0202] CYP2C19*2 (rs4244285) downstream primer CGCAAGCAGTCACATAACTAAGC;
[0203] PCR primer 3 (SEQNO3):
[0204] CYP2C19*3 (rs4986893) upstream primer 5'Biotin-TCCCTGCAATGTGATC...
PUM
Property | Measurement | Unit |
---|---|---|
Diameter | aaaaa | aaaaa |
Diameter | aaaaa | aaaaa |
Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com