A kind of 7-o-glycosyltransferase and its coding gene and application
A technology for glycosyltransferase and encoding gene, which is applied to 7-O-glycosyltransferase and its encoding gene and application fields, and can solve the problems of complex metabolic pathways, multiple identified genes and their functions, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1: PSPG conserved domain prediction glycosyltransferase gene
[0046] Search the epimedium sagittarius transcriptome database through a conserved sequence of about 44 amino acids at the C-terminus of the glycosyltransferase protein (PSPG box: Plant Secondary Product Glycosyltransferase), and obtain multiple candidate sequences of different glycosyltransferase genes.
Embodiment 2
[0047] Example 2: qRTPCR expression analysis of candidate genes and analysis of icariin content in Epimedium sagittatum leaves
[0048] Extract different developmental stages (the definition of different developmental stages is as follows figure 1Shown) the total RNA of Epimedium leaves, using Prime Script RT Reagent Kit With gDNA Eraser (Takara Company) for digestion and reverse transcription of genomic DNA, respectively. The reaction system for genomic DNA digestion is as follows: 5X gDNA Eraser Buffer 2.0ul, gDNA Eraser 1.0ul, total RNA 1ug, RNase Free H 2 O to 10ul; react at 42°C for 2min; place the system on ice after completion. The reverse transcription reaction system is as follows: Genomic DNA digestion reaction system 10ul, 5X PrimeScript Buffer 2 (for real time) 4.0ul, PrimeScript RT Enzyme Mix I 1.0ul, RT Primer Mix 1.0ul, RNase Free dH 2 O 4.0ul; after reacting at 37°C for 15 minutes, keep at 85°C for 5 seconds; the obtained product is the cDNA of Epimedium leav...
Embodiment 3
[0054] Embodiment 3: Cloning and isolation of EsGT1 gene
[0055] The EsGT1 gene was clustered with glycosyltransferase genes with known functions in other species to construct the NJ number ( Figure 4 ), predicted to function as 3-O-glycosylation or 7-O-glycosylation. Design a pair of primers in the EsGT1 coding region (forward primer: GGTACC ATGGGTTCCATCAACGAACAAAC; reverse primer: CTCGAG TTACTTTCCATTTACTTTTTTCCTCCTTTC; the underline is the restriction site, where the restriction site of the forward primer is KpnI, and the restriction site of the reverse primer is XhoI, which is ready for the construction of the expression vector), the total volume of the PCR reaction system is 50uL, including inversion 2uL of the recorded cDNA template, 1×Ex Taqbuffer, 0.2mM dNTP, 1uM primer (half of the forward primer and half of the reverse primer), 1U Ex Taq DNA polymerase (Takara company, the same below), add ddH 2 0 to 50uL. The reaction program was: denaturation at 94°C for 3 m...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


