Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of 7-o-glycosyltransferase and its coding gene and application

A technology for glycosyltransferase and encoding gene, which is applied to 7-O-glycosyltransferase and its encoding gene and application fields, and can solve the problems of complex metabolic pathways, multiple identified genes and their functions, etc.

Active Publication Date: 2019-10-08
SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The entire metabolic pathway is relatively complex, and there are many genes and their functions that need to be identified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of 7-o-glycosyltransferase and its coding gene and application
  • A kind of 7-o-glycosyltransferase and its coding gene and application
  • A kind of 7-o-glycosyltransferase and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: PSPG conserved domain prediction glycosyltransferase gene

[0046] Search the epimedium sagittarius transcriptome database through a conserved sequence of about 44 amino acids at the C-terminus of the glycosyltransferase protein (PSPG box: Plant Secondary Product Glycosyltransferase), and obtain multiple candidate sequences of different glycosyltransferase genes.

Embodiment 2

[0047] Example 2: qRTPCR expression analysis of candidate genes and analysis of icariin content in Epimedium sagittatum leaves

[0048] Extract different developmental stages (the definition of different developmental stages is as follows figure 1Shown) the total RNA of Epimedium leaves, using Prime Script RT Reagent Kit With gDNA Eraser (Takara Company) for digestion and reverse transcription of genomic DNA, respectively. The reaction system for genomic DNA digestion is as follows: 5X gDNA Eraser Buffer 2.0ul, gDNA Eraser 1.0ul, total RNA 1ug, RNase Free H 2 O to 10ul; react at 42°C for 2min; place the system on ice after completion. The reverse transcription reaction system is as follows: Genomic DNA digestion reaction system 10ul, 5X PrimeScript Buffer 2 (for real time) 4.0ul, PrimeScript RT Enzyme Mix I 1.0ul, RT Primer Mix 1.0ul, RNase Free dH 2 O 4.0ul; after reacting at 37°C for 15 minutes, keep at 85°C for 5 seconds; the obtained product is the cDNA of Epimedium leav...

Embodiment 3

[0054] Embodiment 3: Cloning and isolation of EsGT1 gene

[0055] The EsGT1 gene was clustered with glycosyltransferase genes with known functions in other species to construct the NJ number ( Figure 4 ), predicted to function as 3-O-glycosylation or 7-O-glycosylation. Design a pair of primers in the EsGT1 coding region (forward primer: GGTACC ATGGGTTCCATCAACGAACAAAC; reverse primer: CTCGAG TTACTTTCCATTTACTTTTTTCCTCCTTTC; the underline is the restriction site, where the restriction site of the forward primer is KpnI, and the restriction site of the reverse primer is XhoI, which is ready for the construction of the expression vector), the total volume of the PCR reaction system is 50uL, including inversion 2uL of the recorded cDNA template, 1×Ex Taqbuffer, 0.2mM dNTP, 1uM primer (half of the forward primer and half of the reverse primer), 1U Ex Taq DNA polymerase (Takara company, the same below), add ddH 2 0 to 50uL. The reaction program was: denaturation at 94°C for 3 m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses 7-O-glycosyltransferase and an encoding gene and application thereof. The amino acid sequence of the 7-O-glycosyltransferase is shown as a SEQ ID NO.2, and the nucleotide sequence of the 7-O-glycosyltransferase encoding gene EsGT1 is shown as a SEQ ID NO.1. The cloned 7-O-glycosyltransferase provided by the invention is applied to the last step of an icariin synthesizing process, and is of a great significance in analysis of an icariin synthesizing route. The 7-O-glycosyltransferase can specifically catalyze a 7-O-glycosylation reaction of a flavonoid substance (kaempferol).

Description

technical field [0001] The invention belongs to the field of plant genetic engineering and biotechnology, and specifically relates to a 7-O-glycosyltransferase, its coding gene and application. Background technique: [0002] Epimedium is a perennial herb belonging to the genus Epimedium in the family Berberidaceae. In the history of medicinal use in China, the use of Epimedium plants is very long, and it has been recorded in "Shen Nong's Herbal Classic" more than 2,000 years ago. In traditional Chinese medicine, Epimedium plants have been used for tonifying kidney yang, strengthening muscles and bones, and dispelling rheumatism. Based on the extensive use of traditional medicinal plants, with the research on the morphological classification, geographical distribution, quality evaluation, chemical composition and pharmacological effects of Epimedium plants, Epimedium plants have shown great potential for development, and are highly valued. It has attracted more and more att...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12P19/60
Inventor 王瑛杨小满陈建军曾少华
Owner SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI