CAR-T cell capable of efficiently and stably expressing inhibiting antibody and application thereof

An inhibitory and cellular technology, applied in the field of CAR-T cells, can solve the problems of lack of CAR-T therapeutic targets, difficulties in packaging and preparation of retroviruses or lentiviruses, and functional insufficiency

Pending Publication Date: 2017-12-29
SHANGHAI CELL THERAPY RES INST +1
View PDF5 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] 2. Lack of suitable CAR-T therapeutic targets
[0011] Although there have been reports of transfection of exogenous genes into, for example, T cells, the commonly used gene transfection vector systems have a low transfection rate of effector immune cells with cell killing toxicity, or it is difficult to make exogenous genes in their cells at a high level. Express
The use of adenovirus vectors (non-integrated) can mediate the efficient short-term expression of exogenous genes in T cells, but the proliferation of activated T cells is very fast, and the expression cassettes of exogenous genes carried will be quickly lost during cell passage , the expression is difficult to last; the integration of exogenous genes in the T cell genome can be mediated by retrovirus or lentivirus, and stable expression can be achieved in theory, but the antibody contains light chain and heavy chain, and the coding sequence is long and the molecular weight is large, resulting in Retroviruses or lentiviruses carrying full-length antibody expression cassettes are difficult to package and prepare, and it is difficult to express antibodies efficiently (for example, using CAR-T cells to express antibodies, the concentration is only 200ng / ml, Oncotarget.2016Apr 29.doi:10.18632 / oncotarget.9114), generally used to express single-chain antibodies with simple structure (lack of constant region fragments, incomplete function and short half-life)
Therefore, before this, there are no reports of transgenic cells that have cytotoxicity and can stably and high-level express antibodies containing human constant regions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CAR-T cell capable of efficiently and stably expressing inhibiting antibody and application thereof
  • CAR-T cell capable of efficiently and stably expressing inhibiting antibody and application thereof
  • CAR-T cell capable of efficiently and stably expressing inhibiting antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0106] Example 1: Construction of recombinant plasmid pNB328-herinCAR-PD1

[0107] According to the herinCAR coding sequence shown in SEQ ID NO: 1 containing the CD20-Rituximab molecular brake (targeting the CAR of the EGFR family, see CN 201510812654.9) and the coding sequence of herinCAR-PD1 shown in SEQ ID NO: 2 (targeting the EGFR family and containing CD20-Rituximab Molecular Brake CAR and PD1 single-chain-Fc antibody, connected with 2A in the middle), entrusted Shanghai Jereh Biological Company to synthesize, and introduced EcoRI and SalI restriction sites in the upstream and downstream respectively, loaded into pNB328 vector, respectively Named pNB328-herinCAR, pNB328-herinCAR-PD1.

[0108] HerinCAR coding sequence containing CD20-rituximab molecular brake:

[0109] GCCACCATGGAGTTTTGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGTCCAGTGT GGTGGAGGTGGAGGTGGAGGTGGAGGTGGTACCCACTCACTGCCCCCGAGGCCAGCTGCAGTTCCTGTCCCTCTGCGCATGCAGCCTGGCCCAGCCCACCCTGTCCTATCCTTCCTCAGACCCTCTTGGGACCT...

Embodiment 2

[0113] Example 2: Construction of herinCAR-PD1 cells

[0114] Prepare 1×10 7 Freshly isolated peripheral blood mononuclear cells (PBMC) were transfected with 6 μg of the pNB328-herinCAR-PD1 plasmid into the nucleus through a Lonza 2b-Nucleofector instrument, and placed at 37°C, 5% CO 2 Culture in an incubator; transfer to a 6-well plate containing 30ng / mL anti-CD3 antibody and 3000IU / mL IL-2 (purchased from Novoprotein Company) after 6 hours, and place at 37°C, 5% CO 2 Incubator culture. After the cells were confluent, they were subcultured at a ratio of 1:5. That is, genetically modified T cells that simultaneously express the targeting EGFR family and contain CD20-rituximab molecular brake CAR and PD1 single-chain-Fc antibody, referred to as herinCAR-PD1 cells. At the same time, PBMCs from the same source were transfected with the pNB328-herinCAR plasmid to obtain herinCAR-T cells.

Embodiment 3

[0115] Example 3: Quantitative detection of PD1 antibody expression in herinCAR-PD1 cells

[0116] Subculture the herinCAR-PD1 and herinCAR cells prepared in Example 2 at a dilution ratio of 1:3. 6 Cells / well were spread in a 6-well plate with 4ml of AIM-V medium (purchased from Gibco), placed at 37°C, 5% CO 2 Culture in an incubator, and collect 800 μl of cell supernatant after 24 hours, 48 ​​hours, 72 hours, and 96 hours of culture, and store at -20°C for future use. Human PD1 recombinant protein was used to coat the microtiter plate (purchased from SinoBiological Company), and HRP-labeled mouse anti-human IgG mAb (purchased from Abcam Company) was used for detection, and commercialized anti-PD1 antibody (purchased from Merck Company) was used as For standard products, the expression level of PD1 antibody was detected by double-sandwich ELISA method.

[0117] turn out, herin CAR-PD1 The cells can express PD1 antibody stably at a high level, as shown in figure 2 shown...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a CAR-T cell capable of efficiently and stably expressing an inhibiting antibody and application thereof. Specifically, the invention provides a transgenic T cell, and the genome of the transgenic T cell is stably integrated with expression cassettes containing nucleic acid sequences coding chimeric antigen receptors and immune checkpoint inhibiting antibodies, wherein two ends of the expression cassettes contain inverted terminal repeats of transposons. In the genome of the pluripotent CAR-T cell, the expression cassettes of the inhibiting antibodies are stably integrated via a transposon system, so the CAR-T cell has the activity of stably and efficiently expressing the inhibiting antibodies on the premise that original killing activity of the T cell is maintained, transfer-back CAR-T cells are prevented from inhibition by a tumor microenvironment, and residual tumor-specific T cells can be activated in situ. Meanwhile, a molecular brake system is introduced to ensure the security of CAR-T cell therapy, and transfer-back pluripotent CAR-T cells can be timely removed if necessary.

Description

technical field [0001] The invention belongs to the field of cell biology and oncology, and relates to a CAR-T (Chimeric antigen receptor, CAR) cell capable of stably expressing an inhibitory antibody at a high level. Background technique [0002] Immunotherapy against malignant tumors has developed rapidly in recent years and has achieved remarkable clinical efficacy. Among them, the immune checkpoint (such as CTLA4, PD1 / PDL1) monoclonal antibody therapy plays a role by in situ activation of the patient's residual tumor-specific T cells, and the overall effective rate for a variety of malignant tumors reaches 30%. Efficacy and long-term survival; transgenic CAR-T / TCR-T cell therapy is to quickly obtain tumor-specific T cells through in vitro genetic modification, and then adoptive reinfusion for treatment to play a role in the treatment of relapsed and refractory B-cell leukemia. The remission rate was over 90%. [0003] A chimeric antigen receptor (Chimeric Antigen Recep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10A61K35/17A61P35/00A61P31/12A61P31/04A61P37/02C12N15/85
CPCC12N5/0636C12N15/85C12N2510/00C12N2800/90C12N2800/107A61K2239/53A61K39/464411A61K39/464404A61K39/4631A61K39/4611A61K39/464424A61K2239/31A61K2239/38A61K39/395C12N5/10A61P35/00
Inventor钱其军金华君胥阶英李林芳叶真龙何周江芏青吴红平
OwnerSHANGHAI CELL THERAPY RES INST