Specific primers for identification of Rhodiola crenulata at Mila mountain region in Tibet and identification method thereof
A technology of Rhodiola grandiflora and specific primers, which is applied in biochemical equipment and methods, microbiological measurement/inspection, DNA/RNA fragments, etc., can solve the problem of no discovery and achieve short time consumption, low technical threshold, high The effect of accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Using the primer sequence:
[0025] 5'TCCGTTGCTGAATGTCTGTC3' and 5'ATCAAGCATGATTGTTGCGT3', the primer sequence is: SEQ ID No1-2. The specific steps for the detection method of Rhodiola grandiflora plants in the Mila Mountain area of Tibet are as follows:
[0026] (1) Use the improved CTAB method to extract Rhodiola genomic DNA: Take 200 mg of young cauliflower leaves, grind them into powder in liquid nitrogen, transfer them to a 1.5 ml centrifuge tube, add 600 microliters of CTAB lysate, and incubate at 65°C for 30 Minutes, add 450 microliters of chloroform and 18 microliters of isoamyl alcohol, mix thoroughly, centrifuge, take the supernatant and add 1 times the volume of chloroform, mix well and centrifuge, take the supernatant and add 2 times the volume of ethanol, mix After uniformity, place it at -20°C for 30 minutes, centrifuge at 13000rmp for 15 minutes, remove the supernatant, rinse the precipitate with 75% ethanol and air-dry, add 200 microliters of 0.3mol / L...
Embodiment 2
[0032] Comparative Test
[0033]
[0034] The coincidence rate between the results identified by the above method and the planting area was 98%. The coincidence rate between the identification results of the conventional method and the planting area is 92%, which shows that the method of the present invention has higher accuracy, and the method has important application value in the identification of Rhodiola grandiflora in the Mila Mountain area of Tibet.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


