Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer and probe for detecting porcine circovirus type 2 (PCV2), fluorescence quantitative PCR kit, method and application

A porcine circovirus and fluorescence quantitative technology, applied in the field of virus PCR detection, can solve the problems of insufficient specificity, sensitivity and timeliness, and achieve the effect of high sensitivity, simple technical tools and strong specificity

Inactive Publication Date: 2018-05-01
SHANDONG NEW HOPE LIUHE GROUP
View PDF10 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These conventional methods have deficiencies in specificity, sensitivity and timeliness when used for PCV2 detection, especially in the early diagnosis of viral infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe for detecting porcine circovirus type 2 (PCV2), fluorescence quantitative PCR kit, method and application
  • Primer and probe for detecting porcine circovirus type 2 (PCV2), fluorescence quantitative PCR kit, method and application
  • Primer and probe for detecting porcine circovirus type 2 (PCV2), fluorescence quantitative PCR kit, method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Primers and Probes

[0046] The embodiment of the present invention provides a kind of primer and probe for specific detection of porcine circovirus type 2, wherein:

[0047] The primer sequences are as follows:

[0048] Upstream primer: 5'CTACTGCTGTGAGTACCTTGTTGGA 3',

[0049] Downstream primer: 5' CAGGGTGCTGCTCTGCAA 3';

[0050] The probe sequence is as follows:

[0051] 5' FAM-AGCGGGAGTCTGGT-MGB 3'.

Embodiment 2

[0052] Example 2 Fluorescent quantitative PCR detection reagent

[0053] The embodiment of the present invention provides a fluorescent quantitative PCR detection reagent for detecting porcine circovirus type 2, which includes the following components: reaction mixture, water and primers for detecting porcine circovirus type 2 and Probe; where,

[0054] The primer sequences are as follows:

[0055] Upstream primer: 5'CTACTGCTGTGAGTACCTTGTTGGA 3',

[0056] Downstream primer: 5' CAGGGTGCTGCTCTGCAA 3';

[0057] The probe sequences are as follows:

[0058] 5' FAM-AGCGGGAGTCTGGT-MGB 3'.

[0059] The reaction mixture was Premix Ex Taq (Probe qPCR) produced by TaKaRa Company; the water was RNase-free Water produced by TaKaRa Company.

Embodiment 3

[0060] Example 3 Fluorescent quantitative PCR kit

[0061] The embodiment of the present invention provides a fluorescent quantitative PCR kit for preparing and detecting porcine circovirus type 2, specifically a kit containing the fluorescent quantitative PCR detection reagent of Example 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and a probe for detecting porcine circovirus type 2 (PCV2), a fluorescent quantitative PCR kit, a method and application, wherein the primer has the following nucleotide sequences: the upstream primer is 5'CTACTGCTGTGAGTACCTTGTTGGA 3', the downstream primer is 5'CAGGGTGCTGCTCTGCAA 3'; the sequence of the probe is as follows: 5'FAM-AGCGGGAGTCTGGT-MGB 3'. The invention have the beneficial effects that by adopting the kit disclosed by the invention, PCV2 can be quickly and accurately detected, and the kit has a good linear relationship in the template range of 5.0*10<1> to 5.0*10<9>copies*muL<-1>, has the sensitivity which is 100 times that of conventional PCR, no cross reaction with other swine viruses, and a repeatability test variation coefficient which isless than 1.5%; compared with the conventional PCR method, the method is higher in positive detection rate. In summary, the method has strong specificity, high sensitivity and good repeatability and provides a rapid and accurate detection means for laboratory diagnosis and epidemiological investigation of PCV2.

Description

technical field [0001] The invention relates to the technical field of virus PCR detection, in particular to a primer and a probe for detecting porcine circovirus type 2, a fluorescent quantitative PCR kit, a method and an application. Background technique [0002] Porcine circovirus (PCV) belongs to the family Circoviridae and the genus Circovirus. It is a non-enveloped single-stranded circular DNA virus and the smallest animal virus found so far. PCV has three serotypes, PCV1, PCV2 and PCV3. PCV1 is a conventional virus that can infect pigs and is not pathogenic to pigs. PCV2 was first reported in 1998 and is pathogenic to pigs. Clinically, it mainly causes post-weaning multisystemic wasting syndrome (PMWS), dermatitis-nephropathy syndrome (Porcine dermatitis and nephropathy syndrome, PDNS), Reproductive disorders, as well as respiratory and enteric diseases, cause significant economic losses to the swine industry worldwide. In 2016, a new circovirus serotype, PCV3, w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q1/701C12Q2531/113C12Q2563/107C12Q2545/114
Inventor 李晓菲秦立廷陈婷魏笑笑
Owner SHANDONG NEW HOPE LIUHE GROUP
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More