Primer and probe for detecting porcine circovirus type 2 (PCV2), fluorescence quantitative PCR kit, method and application
A porcine circovirus and fluorescence quantitative technology, applied in the field of virus PCR detection, can solve the problems of insufficient specificity, sensitivity and timeliness, and achieve the effect of high sensitivity, simple technical tools and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1 Primers and Probes
[0046] The embodiment of the present invention provides a kind of primer and probe for specific detection of porcine circovirus type 2, wherein:
[0047] The primer sequences are as follows:
[0048] Upstream primer: 5'CTACTGCTGTGAGTACCTTGTTGGA 3',
[0049] Downstream primer: 5' CAGGGTGCTGCTCTGCAA 3';
[0050] The probe sequence is as follows:
[0051] 5' FAM-AGCGGGAGTCTGGT-MGB 3'.
Embodiment 2
[0052] Example 2 Fluorescent quantitative PCR detection reagent
[0053] The embodiment of the present invention provides a fluorescent quantitative PCR detection reagent for detecting porcine circovirus type 2, which includes the following components: reaction mixture, water and primers for detecting porcine circovirus type 2 and Probe; where,
[0054] The primer sequences are as follows:
[0055] Upstream primer: 5'CTACTGCTGTGAGTACCTTGTTGGA 3',
[0056] Downstream primer: 5' CAGGGTGCTGCTCTGCAA 3';
[0057] The probe sequences are as follows:
[0058] 5' FAM-AGCGGGAGTCTGGT-MGB 3'.
[0059] The reaction mixture was Premix Ex Taq (Probe qPCR) produced by TaKaRa Company; the water was RNase-free Water produced by TaKaRa Company.
Embodiment 3
[0060] Example 3 Fluorescent quantitative PCR kit
[0061] The embodiment of the present invention provides a fluorescent quantitative PCR kit for preparing and detecting porcine circovirus type 2, specifically a kit containing the fluorescent quantitative PCR detection reagent of Example 2.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap