37 results about "Swine virus" patented technology

The invention provides a Chinese herbal medicinal feed additive for preventing and controlling swine infectious disease. The swine feed additive consists of 37 Chinese medicinal herbs, namely, gypsum, rehmannia root, rhinoceros horn, golden thread, cape jasmine fruit, tree peony bark, baical skullcap root, red paeony root, figwort root, common anemarrhena rhizome, forsythia suspensa , platycodon root, liquorice root, common lophatherum herb, amur corktree bark, honeysuckle flower, Chinese pulsatilla root, indigowoad root, heartleaf houttuynia herb, astragalus, szechwon tangshan root, hawkthorn fruit, medicated leaven, barley sprout, radish seed, chicken's gizzard -membrane, Chinese thorowax root, common andrographis herb, philippine violet herb, tuber fleeceflower root, massa medicata fermentata fujianensis, cyrtomium rhizome, tung leaf, tangerine peel, white paeony root, pine needle and indigowoad leaf through scientific compatibility. The feed additive is added into swine feed in the proportion; under the condition of not using any vaccine, the feed additive can effectively prevent and cure severe mixed flu symptoms, infection and other syndromes caused by swine respiratory disease, asthma, contagious pleuropneumonia, swine virus mixed flu, high swine fever, porcine circovirus, swine fever, flu, pseudorabies, salmonellosis, bacillosis, streptococcus, erysipelas, paratyphoid, eperythrozoon, toxoplasm and other multi-pathogeny and provides genuine green food for the market.

The invention discloses an RPA (recombinase polymerase amplification) primer and a detection kit for rapidly detecting African swine fever viruses. Target genes can be effectively amplified, specificity is 100%, detection sensitivity is 102 copy/reaction, and sensitivity is equivalent to that of fluorescent quantitative PCR (polymerase chain reaction). Cross reaction between the RPA amplificationprimer and one of classical swine fever viruses, vesicular exanthema swine viruses I, porcine reproductive and respiratory syndrome viruses, porcine circoviruses and the like is omitted. A RPA isothermal amplification system is rapidness in reaction and wide in temperature range, effective amplification of the target genes can be achieved at the temperature of 38-46 DEG C, and the detection kit can rapidly, efficiently and sensitively detect the African swine fever viruses and has the advantages that the kit is simple to operate, high in specificity, safe and free from pollution, reaction results are easily observed and the like. Effective technical means are provided for on-site rapidness detecting and screening of infection nucleic acid of the African swine fever viruses, and the RPA amplification primer has great significance for control of infection spreading of the African swine fever viruses in China and inspection and quarantine in infected areas and entry and exit ports.

The invention provides a monoclonal antibody specially bound to TGEV (transmissible gastroenteritis of swine virus) and a kit prepared from the monoclonal antibody. The TGEV can be determined rapidlyand accurately, and strains can be widely determined. Pharmaceutical composition prepared from the antibody can be used for broad-spectrum prevention and treatment of different TGEVs.

The invention relates to an anti-African swine fever virus p54 protein monoclonal antibody and a preparation method and application thereof. According to the invention, polypeptide capable of simulating conservative p54 protein NTD is designed and synthesized, and the polypeptide is coupled with BSA to serve as immunogen, an anti-ASFVp54 protein monoclonal antibody is prepared by immunizing a BALB/c mouse through an immunological method, the obtained antibody can specifically identify and bind to an N-terminal region of p54 protein, and the recognition region (aa 1-29) is different from the existing commercial monoclonal antibody. The invention provides gene sequences of a heavy chain variable region and a light chain variable region of the antibody. On this basis, the monoclonal antibodyof the invention can be obtained by adopting a conventional genetic engineering method or a protein engineering method. The monoclonal antibody is high in specificity and high in sensitivity, capableof specifically reacting with the ASFV HLJ/18 virus strain, without reaction with CSFV, PCV2, PRRSV, PEDV, PRV and other swine viruses, thus laying a foundation for the research of ASFV etiology and pathogenesis and the clinical detection research of ASFV pathogens.

The invention provides a medicine composition capable of preventing Africa swine fever, an extractive thereof, an injection and application. The medicine composition is prepared from, by weight, 10-30parts of lucid ganoderma, 4-12 parts of Drosera burmanii, 4-12 parts of Harrisonia perforata, 30-50 parts of areca nuts, 4-12 parts of Callicarpa nudiflora, 4-12 parts of epigeal srephaia roots and 4-12 parts of common nepenthes. The medicine composition has the efficient prevention effect on Africa swine fever, can be widely applied to preventing Africa swine virus, and solves the major problemof the pork industry.

The invention belongs to the field of virus diagnosis and detection, solves the technical problems of complicated and long time for detecting porcine boca virus in the prior art, and provides a kit for detecting porcine boca virus, which contains a fluorescent PCR reaction solution, The fluorescent PCR reaction solution contains specific primers, and the sequence of the upstream primer is shown in SEQ ID NO: 1, and the sequence of the downstream primer is shown in SEQ ID NO: 2; it also contains a TaqMan specific probe for porcine boca virus, The sequence of the probe is shown in SEQ ID NO: 3, and it also contains the DNA positive control of the Boca virus plasmid. The present invention also provides a method for detecting porcine Boca virus by using the above-mentioned kit. The kit of the invention can quickly and accurately detect porcine boca virus, has simple operation, short time consumption, high sensitivity and strong specificity, and can qualitatively or quantitatively detect porcine boca virus in various types of specimens.

The invention discloses a primer and a probe for detecting porcine circovirus type 2 (PCV2), a fluorescent quantitative PCR kit, a method and application, wherein the primer has the following nucleotide sequences: the upstream primer is 5'CTACTGCTGTGAGTACCTTGTTGGA 3', the downstream primer is 5'CAGGGTGCTGCTCTGCAA 3'; the sequence of the probe is as follows: 5'FAM-AGCGGGAGTCTGGT-MGB 3'. The invention have the beneficial effects that by adopting the kit disclosed by the invention, PCV2 can be quickly and accurately detected, and the kit has a good linear relationship in the template range of 5.0*10<1> to 5.0*10<9>copies*muL<-1>, has the sensitivity which is 100 times that of conventional PCR, no cross reaction with other swine viruses, and a repeatability test variation coefficient which isless than 1.5%; compared with the conventional PCR method, the method is higher in positive detection rate. In summary, the method has strong specificity, high sensitivity and good repeatability and provides a rapid and accurate detection means for laboratory diagnosis and epidemiological investigation of PCV2.

The invention belongs to the technical field of biology, and experimental research finds for the first time that a protein encoded by an SVA 3C gene can be used as a virus replication enhancer to significantly promote replication of swine viruses including attenuated vaccine strains and inactivated vaccine strains. Therefore, the problems of low virus yield and low vaccine immunogenicity in production and practice at present are well solved. The invention not only provides a new direction for revealing a virus mixed infection mechanism, but also can apply the SVA 3C protein to improve the yield of viruses in production practice, and is more beneficial to optimizing the construction strategies of related genetic engineering live vaccines and live virus vaccine vectors and improving the immune activity of the vector vaccines.

The invention relates to the technical field of virus detection, and particularly discloses a primer and kit for simultaneously detecting PEDV, PRRSV, TGEV and PoRV and a use method thereof. The PCR detection primer provided by the invention can be used for simultaneously detecting four kinds of viruses including the PEDV, the PRRSV, the TGEV and the PoRV, has no cross amplification reaction withswine fever virus, swine Japanese encephalitis virus, swine Bocavirus, porcine circovirus 2, swine delta circovirus, porcine pseudorabies virus and other swine viruses, and has relatively strong specificity; and the primer is high in sensitivity, the lowest detection concentrations of the primer to the PEDV, the PRRSV, the TGEV and the PoRV are 9.12x10<5> pg/[mu]L, 2.48x10<3> pg/[mu]L, 7.55x10<5>pg/[mu]L and 8.23x10<5> pg/[mu]L respectively, and the detection accuracy is 100%.

The invention belongs to the field of biological medicines, and particularly relates to a method for screening CTL (cytotoxic T lymphocyte) epitopes by an independently constructed SLA-2-HB01-pCDH/sT2 cell line. According to the invention, an exogenous SLA-2-HB01 gene is transfected to an sT2 cell, and a stable SLA-2 gene expression model is established. The method comprises the following steps: loading EB155 and other positive epitope peptides on the surfaces of cells, detecting an SLA-2-peptide-beta2m complex expressed on the surfaces of the cells through FACs, and judging that the SLA-2-HB01-pCDH/sT2 has the function of presenting exogenous polypeptide epitopes. In order to promote the formation of cell surface complexes, the addition of the beta2m is beneficial to the improvement of the presentation efficiency of the antigen polypeptide. In the result of the invention, As63, EB155 and Hu62 peptides can be presented by an SLA-2-HB01-pCDH/sT2 cell line, As63 is presented in the SLA-2-HB01-pCDH/sT2, SLA-2-HB01-Flag-pCDH/sT2 and SLA-2-HB01-3 * Flag-pCDH/in the sT2 cell line, and the presentation efficiency is basically consistent, which indicates that a series of sT2 for expressing the SLA-2-HB01 gene constructed by the invention has the function of presenting the antigen, and the SLA-2-HB01-3 * Flag-pCDH/sT2 can be used for expressing the SLA-2-HB01 gene. Therefore, the SLA-2 heavy chain molecule can be used for screening polypeptide epitopes of the swine viruses on the cellular level, and it is further proved that the antigen presentation function of a cell line is not affected when a Flag tag is added to the C-terminal of the SLA-2 heavy chain molecule.

The invention discloses a preparation method for a lyophilized agent of swine interferon, belonging to the field of animal vaccines. The preparation method for the lyophilized agent of swine interferon comprises the following six steps: acquiring fresh blood of a healthy pig under aseptic conditions, centrifuging the blood at 4 DEG C for 20 min, sucking up leucocytes at a middle layer, washing the leucocytes with NH4Cl with a mass fraction of 0.85% twice, then carrying out centrifugation, collecting precipitated leucocytes, removing NH4Cl, adding the leucocytes into an Eagle's MEM mixed nutrient solution containing 5% of swine serum according to a volume ratio of the leucocytes to the nutrient solution of 1: 15, carrying out suspension and diluting the swine leucocytes until the number of the swine leucocytes is in a range of 10 * 10<7>/ml to 25 * 10<7>/ml so as to prepare a swine leucocyte suspension liquid; etc. The preparation method is capable of preparing the long-acting swine virus interferon preparation which is injected once every 10 days and has good effect on swine viral diseases.

The invention provides an RT-CPA detection primer and kit for swine transmissible gastroenteritis virus, and belongs to the technical field of swine virus disease virus detection, the RT-CPA detection primer comprises SD-CPF, SD-CPR, SD-F, SD-R, SD-DF and SD-DR; and the nucleotide sequences are shown as SEQ ID No.1-6 in sequence. The primer provided by the invention is good in specificity and can effectively detect the swine transmissible gastroenteritis virus; the method is rapid and efficient, the detection time is about 90 min, and the method is very suitable for on-site rapid detection of TGEV; the method does not depend on expensive instruments and equipment and professional detection personnel, and the detection cost is low; the detection result is simple, objective and visual to judge; the sensitivity is high, and 10 copies/mu L of TGEV can be detected.