Primer probe combination for KRAS gene mutation detection and application thereof
A technology for primer probes and detection primers, applied in the field of molecular biology, can solve the problems of difficult universal use, insufficient detection accuracy and specificity of detection reagents, and achieve the effect of increasing sensitivity and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0098] The assembly of embodiment 1 kit
[0099] The design of the primer probe combination, the specific sequence is shown in Table 1 below:
[0100] Table 1
[0101]
[0102]
[0103]
[0104] Wherein, the mismatch rate of the KRAS gene mutation detection specific primer pair is 22%, and the base overlapping sequence between the amplification blocking probe and the downstream primer in the KRAS gene mutation detection specific primer pair is 9 bp;
[0105] Negative quality control: the negative quality control is TE buffer;
[0106] Positive quality control product: KRAS gene mutant plasmid, the nucleotide sequence of the mutant plasmid is shown in SEQ ID NO.18, and the specific sequence is as follows:
[0107] AAGAACTGTCTATGTAGCATTTATGCATTTTTCTTAAGCGTCGATGGAGGAGTTTGTAAATGAAGTACAGTTCATTACGATACACGTCTGCAGTCAACTGGAATTTTCATGATTGAATTTTGTAAGGTATTTTGAAATAATTTTTCATATAAAGGTGAGTTTGTATTAAAAGGTACTGGTGGAGTATTTGATAGTGTATTAACCTTATGTGTGACATGTTCTAATATAGTCACATTTTCATTATTTTTATTATAAGG...
Embodiment 2
[0110] Embodiment 2 KRAS gene mutation detection
[0111] The kit in Example 1 is used to detect KRAS gene mutation, including the following steps:
[0112] (1) Sample DNA extraction:
[0113] Take paraffin-embedded pathological tissue sections of non-small cell lung cancer (sample 1), thyroid cancer (sample 2) and colorectal cancer (sample 3), and use QIAamp DNA FFPE Tissue Kit (Cat.no.56404) of QIAGEN to extract paraffin For embedding tissue slice samples, the concentration and purity of the extracted DNA should be measured with a UV spectrophotometer. The DNA OD260 / OD280 value should be 1.8-2.0, and the concentration should be between 3.3-13.2ng / ul;
[0114] (2) preparation system, the concrete system composition is as shown in table 2 below:
[0115] Table 2
[0116]
[0117]
[0118] Add the DNA sample extracted in step (1) to the above reaction system, the DNA sample volume is less than 15ng, add it to the corresponding PCR reaction well, seal the sealing film o...
Embodiment 3
[0144] Compared with Example 1-2, only the base overlap sequence of the amplification blocking probe and the downstream primer in the KRAS gene mutation detection specific primer pair is 2bp, and other components and conditions are the same as those in Example 1-2 same.
[0145] The results showed that non-specific amplification occurred in the detection sample.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com