Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer probe combination for KRAS gene mutation detection and application thereof

A technology for primer probes and detection primers, applied in the field of molecular biology, can solve the problems of difficult universal use, insufficient detection accuracy and specificity of detection reagents, and achieve the effect of increasing sensitivity and specificity

Inactive Publication Date: 2018-06-29
无锡禾盛医疗器械有限公司
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the detection accuracy and specificity of the detection reagents of the existing method ARMS-PCR are not high enough, and it is difficult to popularize and use them in a wide range

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer probe combination for KRAS gene mutation detection and application thereof
  • Primer probe combination for KRAS gene mutation detection and application thereof
  • Primer probe combination for KRAS gene mutation detection and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0098] The assembly of embodiment 1 kit

[0099] The design of the primer probe combination, the specific sequence is shown in Table 1 below:

[0100] Table 1

[0101]

[0102]

[0103]

[0104] Wherein, the mismatch rate of the KRAS gene mutation detection specific primer pair is 22%, and the base overlapping sequence between the amplification blocking probe and the downstream primer in the KRAS gene mutation detection specific primer pair is 9 bp;

[0105] Negative quality control: the negative quality control is TE buffer;

[0106] Positive quality control product: KRAS gene mutant plasmid, the nucleotide sequence of the mutant plasmid is shown in SEQ ID NO.18, and the specific sequence is as follows:

[0107] AAGAACTGTCTATGTAGCATTTATGCATTTTTCTTAAGCGTCGATGGAGGAGTTTGTAAATGAAGTACAGTTCATTACGATACACGTCTGCAGTCAACTGGAATTTTCATGATTGAATTTTGTAAGGTATTTTGAAATAATTTTTCATATAAAGGTGAGTTTGTATTAAAAGGTACTGGTGGAGTATTTGATAGTGTATTAACCTTATGTGTGACATGTTCTAATATAGTCACATTTTCATTATTTTTATTATAAGG...

Embodiment 2

[0110] Embodiment 2 KRAS gene mutation detection

[0111] The kit in Example 1 is used to detect KRAS gene mutation, including the following steps:

[0112] (1) Sample DNA extraction:

[0113] Take paraffin-embedded pathological tissue sections of non-small cell lung cancer (sample 1), thyroid cancer (sample 2) and colorectal cancer (sample 3), and use QIAamp DNA FFPE Tissue Kit (Cat.no.56404) of QIAGEN to extract paraffin For embedding tissue slice samples, the concentration and purity of the extracted DNA should be measured with a UV spectrophotometer. The DNA OD260 / OD280 value should be 1.8-2.0, and the concentration should be between 3.3-13.2ng / ul;

[0114] (2) preparation system, the concrete system composition is as shown in table 2 below:

[0115] Table 2

[0116]

[0117]

[0118] Add the DNA sample extracted in step (1) to the above reaction system, the DNA sample volume is less than 15ng, add it to the corresponding PCR reaction well, seal the sealing film o...

Embodiment 3

[0144] Compared with Example 1-2, only the base overlap sequence of the amplification blocking probe and the downstream primer in the KRAS gene mutation detection specific primer pair is 2bp, and other components and conditions are the same as those in Example 1-2 same.

[0145] The results showed that non-specific amplification occurred in the detection sample.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene mutation detection product, in particular to a primer probe combination for KRAS gene mutation detection and application thereof. The primer probe combination comprisesdetection primer probes, wherein the detection primer probes include a KRAS gene mutation detection-specific primer pair, a KRAS gene-specific probe, an amplification blocking probe and an internal reference system, wherein KRAS gene mutation detection sites are 12 and 13 codons of an exon 1, particularly G12S, G12C, G12R, G12D, G12A, G12V and G13D mutation sites. The primer probe combination hasthe advantages of strong specificity, high sensitivity, simple and rapid operation and the like for KRAS gene mutation, a detection result has relatively good accuracy and repeatability, and the primer probe combination can detect a tumor tissue sample, can assist clinical treatment, and has an important value.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a product for detecting gene mutation, in particular to a combination of primers and probes for detecting KRAS gene mutation and its application. Background technique [0002] Lung cancer and colorectal cancer are common malignant tumors in the world today, and have become the main cause of cancer death in most countries. Among them, non-small cell lung cancer (NSCLC) is the most common lung cancer. The KRAS gene is located on chromosome 12p12.1 and is one of the important oncogenes. It encodes a 21kD KRAS protein and participates in intracellular signal transmission, mainly including RAS / P13K / PTEN / AKT and RAS / RAF / MEK / ERK signal transduction These transduction pathways are currently the hotspots in the research of tumor-targeted drugs, and targeted drugs produce pharmacological effects by inhibiting these pathways. Studies have shown that there are KRAS gene mutations i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6886C12Q2600/106C12Q2600/156C12Q2600/166C12Q2531/113C12Q2535/137C12Q2537/163C12Q2561/101
Inventor 盛青松白静姚鲁帅
Owner 无锡禾盛医疗器械有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com