Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Livestock component detection kit and method

A technology for component detection and kits, which is applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., and can solve problems such as reduced food safety trust, adverse social impact, and damage to consumer rights and interests.

Active Publication Date: 2018-07-31
SICHUAN HUAHAN TRIO BIOTECH CO LTD
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In recent years, lawbreakers have used cheap and low-value meat products to mix them with beef, mutton, and donkey meat for sale. The phenomenon of "substituting second-best and fake ones" frequently occurs, especially high-value meat products such as donkey meat are often adulterated There are horse meat, etc.; the "horse meat scandal" in Europe is that beef products are adulterated with horse meat, which is suspected of "selling horse meat with a cow's head"; It has become the hardest-hit area for the adulteration of ordinary beef and buffalo meat; and the mutton on the market mainly includes sheep meat and goat meat, and the price gap between the two is large, so there are criminals in the market who adulterate sheep meat with a lower price to goat meat. The sale of mutton will greatly damage the rights and interests of consumers, and at the same time reduce people's trust in food safety, causing adverse social impacts

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Livestock component detection kit and method
  • Livestock component detection kit and method
  • Livestock component detection kit and method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0093] This embodiment provides a detection kit for animal components, which includes a nucleic acid combination and a membrane chip.

[0094] Wherein, the nucleic acid combination includes the following primer pairs, positive control probe, negative control probe and positive oligonucleotide single-stranded DNA; the 5' end of the downstream primer of each primer pair is labeled with biotin. The base sequence (5'-3') of the upstream primer and the downstream primer of each primer pair is as follows:

[0095] First primer pair for detection of sheep-derived components:

[0096]Upstream primer: GGTGCTATCCTACTAATCCTCA (SEQ ID NO.1), downstream primer: biotin-TGTTAAGTGGGTTTGCTGGGG (SEQ ID NO.2);

[0097] Secondary primer pair for detection of goat-derived components:

[0098] Upstream primer: GGCGCCATGCTACTAATTCTTG (SEQ ID NO.3), downstream primer: biotin-TATTGAGTGGATTTGCTGGG (SEQ ID NO.4);

[0099] The third primer pair for detection of cattle-derived components:

[0100] Ups...

Embodiment 2

[0153] This embodiment provides a method for detecting animal components in a sample using the animal component detection kit of Example 1, the steps are as follows:

[0154] 2.1 Extract the genomic DNA of the sample to be tested according to the CTAB method. After each 50 mg of the sample to be tested is extracted, the DNA solution is diluted to the same mass concentration (100-200 ng / μL) with a micro-nucleic acid analyzer to obtain the DNA template of the sample to be tested. (100-200ng / μL).

[0155] 2.2 Multiplex PCR system and conditions

[0156] The reaction system of multiplex PCR amplification is as follows:

[0157] 10×PCR Buffer: 5 μL;

[0158] dNTP (2.5mM each): 5μL;

[0159] Each primer pair: upstream primer (20 μM): 0.5 μL, downstream primer (20 μM): 0.6 μL, add the first primer pair to the thirteenth primer pair and the internal reference primer pair into the same system;

[0160] EX-Taq Polymerase (Takara, 5U / μL): 0.5μL;

[0161] DNA template of the sample t...

Embodiment 3

[0190] Detect the specificity of the kit provided by Example 1

[0191] The detection method is carried out according to the detection method of Example 2.

[0192] Take samples of known species including sheep, goats, cattle, buffaloes, yaks, horses, donkeys, deer, cats, dogs, camels, horse mules, donkey mules, pigs, chickens, ducks, rabbits, mink, foxes, rats, raccoon dogs, Standard DNAs of 23 species such as fish and turkey were used as templates for specific detection according to the detection method in Example 2.

[0193] The result is as figure 2 As shown, the color development of each positive hybridization point is clear, there is no missed detection or multiple detection phenomenon, and the negative sample has no cross-color development, indicating that the kit provided in Example 1 and the detection method in Example 2 have good detection specificity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a livestock component detection kit and method and relates to the technical field of meat product detection. The kit comprises one or a combination of more of the following primer pairs: SEQ ID NO. 1-2, SEQ ID NO. 3-4, SEQ ID NO. 5-6, SEQ ID NO. 7-8, SEQ ID NO. 9-10, SEQ ID NO. 11-12, SEQ ID NO. 13-14, SEQ ID NO. 15-16, SEQ ID NO. 17-18, SEQ ID NO. 19-20, SEQ ID NO. 21-22,SEQ ID NO. 23-24 and SEQ ID NO. 25-26. When adopted to detect livestock source components, the kit has relatively high specificity and sensitivity and is accurate and reliable in detection result.

Description

technical field [0001] The invention relates to the technical field of meat product detection, in particular to a detection kit and method for livestock components. Background technique [0002] In recent years, lawbreakers have used cheap and low-value meat products to mix them with beef, mutton, and donkey meat for sale. The phenomenon of "substituting second-best and fake ones" frequently occurs, especially high-value meat products such as donkey meat are often adulterated There are horse meat, etc.; the "horse meat scandal" in Europe is that beef products are adulterated with horse meat, which is suspected of "selling horse meat with a cow's head"; It has become the hardest-hit area for the adulteration of ordinary beef and buffalo meat; and the mutton on the market mainly includes sheep meat and goat meat, and the price gap between the two is large, so there are criminals in the market who adulterate sheep meat with a lower price to goat meat. The sale of mutton greatl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6848C12N15/11
CPCC12Q1/6848C12Q1/6888C12Q2600/16C12Q2537/143C12Q2531/113C12Q2565/501
Inventor 彭丽韩嘉钰周航黄莉
Owner SICHUAN HUAHAN TRIO BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com