Livestock component detection kit and method
A technology for component detection and kits, which is applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., and can solve problems such as reduced food safety trust, adverse social impact, and damage to consumer rights and interests.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0093] This embodiment provides a detection kit for animal components, which includes a nucleic acid combination and a membrane chip.
[0094] Wherein, the nucleic acid combination includes the following primer pairs, positive control probe, negative control probe and positive oligonucleotide single-stranded DNA; the 5' end of the downstream primer of each primer pair is labeled with biotin. The base sequence (5'-3') of the upstream primer and the downstream primer of each primer pair is as follows:
[0095] First primer pair for detection of sheep-derived components:
[0096]Upstream primer: GGTGCTATCCTACTAATCCTCA (SEQ ID NO.1), downstream primer: biotin-TGTTAAGTGGGTTTGCTGGGG (SEQ ID NO.2);
[0097] Secondary primer pair for detection of goat-derived components:
[0098] Upstream primer: GGCGCCATGCTACTAATTCTTG (SEQ ID NO.3), downstream primer: biotin-TATTGAGTGGATTTGCTGGG (SEQ ID NO.4);
[0099] The third primer pair for detection of cattle-derived components:
[0100] Ups...
Embodiment 2
[0153] This embodiment provides a method for detecting animal components in a sample using the animal component detection kit of Example 1, the steps are as follows:
[0154] 2.1 Extract the genomic DNA of the sample to be tested according to the CTAB method. After each 50 mg of the sample to be tested is extracted, the DNA solution is diluted to the same mass concentration (100-200 ng / μL) with a micro-nucleic acid analyzer to obtain the DNA template of the sample to be tested. (100-200ng / μL).
[0155] 2.2 Multiplex PCR system and conditions
[0156] The reaction system of multiplex PCR amplification is as follows:
[0157] 10×PCR Buffer: 5 μL;
[0158] dNTP (2.5mM each): 5μL;
[0159] Each primer pair: upstream primer (20 μM): 0.5 μL, downstream primer (20 μM): 0.6 μL, add the first primer pair to the thirteenth primer pair and the internal reference primer pair into the same system;
[0160] EX-Taq Polymerase (Takara, 5U / μL): 0.5μL;
[0161] DNA template of the sample t...
Embodiment 3
[0190] Detect the specificity of the kit provided by Example 1
[0191] The detection method is carried out according to the detection method of Example 2.
[0192] Take samples of known species including sheep, goats, cattle, buffaloes, yaks, horses, donkeys, deer, cats, dogs, camels, horse mules, donkey mules, pigs, chickens, ducks, rabbits, mink, foxes, rats, raccoon dogs, Standard DNAs of 23 species such as fish and turkey were used as templates for specific detection according to the detection method in Example 2.
[0193] The result is as figure 2 As shown, the color development of each positive hybridization point is clear, there is no missed detection or multiple detection phenomenon, and the negative sample has no cross-color development, indicating that the kit provided in Example 1 and the detection method in Example 2 have good detection specificity.
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com