Rab5 nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
A molecular and nucleic acid technology, applied in the field of genetic control, can solve problems such as the mortality rate of coleopteran pests that cannot be provided
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0281] Insect Diet Bioassays
[0282] Sample preparation and bioassays; using RNAi kit or T7 in vitro transcription kit synthesized and purified many dsRNA molecules (including those corresponding to rab5reg1 (SEQ ID NO:7), rab5reg2 (SEQ ID NO:8), rab5reg3 (SEQ ID NO:9) and rab5ver1 (SEQ ID NO:10 )) of those. Purified dsRNA molecules were prepared in TE buffer, which consisted of a control treatment for all bioassays, which served as a background check for mortality or growth inhibition of WCR (Maize root beetle). use NANODROP TM An 8000 Spectrophotometer (THERMOSCIENTIFIC, Wilmington, DE) measured the concentration of dsRNA molecules in the bioassay buffer.
[0283] Samples were tested for insect activity in a bioassay using neonatal insect larvae fed an artificial insect diet. WCR eggs were obtained from CROP CHARACTERISTICS, INC. (Farmington, MN).
[0284] Bioassays were performed in 128-well plastic trays (C-D INTERNATIONAL, Pitman, NJ) specially designed for insec...
Embodiment 2
[0295] Identification of candidate target genes
[0296] Multiple WCR (corn root firefly beetle) developmental stages were selected for pooled transcriptome analysis to provide candidate target gene sequences controlled by RNAi transgenic plant insect resistance technology.
[0297] In one example, total RNA was isolated from approximately 0.9 g of intact first instar WCR larvae (4 to 5 days after hatch; maintained at 16°C) and analyzed using the following phenol / TRI-based The method (MOLECULAR RESEARCH CENTER, Cincinnati, OH) purification:
[0298] Place the larvae in a 10 mL container at room temperature Homogenize in a 15 mL homogenizer until a homogeneous suspension is obtained. After 5 minutes of incubation at room temperature, the homogenate was dispensed into 1.5 mL microcentrifuge tubes (1 mL per tube), and the mixture was vigorously shaken for 15 seconds after the addition of 200 μL of chloroform. After allowing the extraction process to stand at room temperature...
Embodiment 3
[0317] Amplify target genes to generate dsRNA
[0318] Primers were designed to amplify the portion of the coding region of each target gene by PCR. See Table 1. The T7 phage promoter sequence (TTAATACGACTCACTATAGGGAGA; SEQ ID NO: 11 ) was incorporated into the 5' end of the amplified sense or antisense strand, as appropriate. See Table 1. Total RNA was extracted from WCR and the first-strand cDNA was used as template for a PCR reaction employing reverse-positioned primers to amplify all or part of the natural target gene sequence. dsRNA was also amplified from a DNA clone containing the coding region for yellow fluorescent protein (YFP) (SEQ ID NO: 12; Shagin et al. (2004) Mol. Biol. Evol. 21(5):841-50) .
[0319] Table 1. Primers and primer pairs used to amplify portions of the coding regions of exemplary rab5 target genes and YFP negative control genes.
[0320]
PUM
| Property | Measurement | Unit |
|---|---|---|
| length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More